16829 results for "sec+and+unspecified+malignant+neoplasm"

in 19.41 milliseconds.

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Reactivation of telomerase reverse transcriptase (TERT) expression enables cells to overcome replicative senescence and escape apoptosis, fundamental steps in the initiation of human cancer. Multiple cancer types, including up to 83% of glioblastomas (GBM), harbor highly recurrent TERT promoter mutations of unknown function but specific to two nucleotide positions. We identify the functional consequence of these mutations in GBM to be recruitment of the multimeric GABP transcription factor specifically to the mutant promoter. Allelic recruitment of GABP is consistently observed across four cancer types, highlighting a shared mechanism underlying TERT reactivation. Tandem flanking native ETS motifs critically cooperate with these mutations to activate TERT, likely by facilitating GABP heterotetramer binding. GABP thus directly links TERT promoter mutations to aberrant expression in multiple cancers.

  Study EGAS00001001242

• WGS of HSPC clones of healthy individual sequenced with Illumina NovaSeq 6000

  Dataset contains WGS sequecing data from clonally expanded hematopoietic stem cells from 7 individual pediatric cancer patients. Samples were taken before (DX - diagnosis) or Follow-up (DX2/REM/FU - Diagnosis 2, remission or follow-up, respectively). In addtion, cord blood clones (Designated CB) treated with X-ray radiation, Cisplatin, Maphosphamide, Vincristine and Doxorubicin and untreated cord blood hematopoietic stem/progenitor cells were have been whole-genome sequenced. (Abbreviations RAD, CISPL, MAPH, VINC, DOX and CTRL, respectively)

  Dataset EGAD00001007078

• Adult B-precursor acute lymphoblastic leukemia transcriptomes

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of B-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Dataset EGAD00001008633

• RNA-seq data

  RNAseq FASTq files of 181 bulk pre-treatment and 14 post-treatment tumors from GO30140 Ph1b group A and F and 177 bulk pre-treatment tumors of IMbrave150 PhIII

  Dataset EGAD00001008128

• A Tumour Organoid Biobank for Mapping Cancer Cell Vulnerabilities - RNA

  RNA sequencing data from cancer patient-derived organoids. Part of a study to include genomic and transcriptomic sequencing data, along with CRISPR screening data from cancer patient-derived organoids and matched tumour tissues. Some organoids were developed as part of the Human Cancer Models Initiative (HCMI) in collaboration with Cancer Research UK (CRUK). The study includes organoids derived from colorectal, oesophageal, ovarian, pancreatic, and stomach cancer samples.

  Dataset EGAD00001015470

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• Tumor Whole-exome sequencing

  20 tumor tissue WES data with paired cfDNA sWGS data. This data is used for concordance analysis between cfDNA-based and tissue-based CNA. The WES libraries were sequenced across 3 independent runs using multiple lanes.

  Dataset EGAD50000001864

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302