17282 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 24.73 milliseconds.

• BIONi010-C-8 / SAMEA4454011 WGS data

  The iPSC line BIONi010-C-8 / SAMEA4454011 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-8 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001028

• BIONi010-C-3 / SAMEA4342740 WGS data

  The iPSC line BIONi010-C-3 / SAMEA4342740 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-3 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001034

• BIONi010-C-7 / SAMEA4454010 WGS data

  The iPSC line BIONi010-C-7 / SAMEA4454010 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-7 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001035

• BIONi010-C-6 / SAMEA4454009 WGS data

  The iPSC line BIONi010-C-6 / SAMEA4454009 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-6 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001037

• BIONi010-C-9 / SAMEA4454012 WGS data

  The iPSC line BIONi010-C-9 / SAMEA4454012 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-9 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001040

• SIGi001-A-3 / SAMEA4448571 WGS data

  The iPSC line SIGi001-A-3 / SAMEA4448571 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-3 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001041

• BIONi010-C-4 / SAMEA4452060 WGS data

  The iPSC line BIONi010-C-4 / SAMEA4452060 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-4 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001043

• EDi014-A / SAMEA4459369 WGS data

  The iPSC line EDi014-A / SAMEA4459369 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line EDi014-A is available for research use at www.EBiSC.org.

  Dataset EGAD50000001051

• EDi014-B / SAMEA4459371 WGS data

  The iPSC line EDi014-B / SAMEA4459371 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line EDi014-B is available for research use at www.EBiSC.org.

  Dataset EGAD50000001053

• SIGi001-A-7 / SAMEA4448730 WGS data

  The iPSC line SIGi001-A-7 / SAMEA4448730 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-7 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001060

• BIONi010-C-5 / SAMEA4452061 WGS data

  The iPSC line BIONi010-C-5 / SAMEA4452061 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-5 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001062

• BIONi010-C-2 / SAMEA4342705 WGS data

  The iPSC line BIONi010-C-2 / SAMEA4342705 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-2 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001068

• SIGi001-A-1 / SAMEA4451096 WGS data

  The iPSC line SIGi001-A-1 / SAMEA4451096 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-1 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001073

• SIGi001-A-10 / SAMEA4451117 WGS data

  The iPSC line SIGi001-A-10 / SAMEA4451117 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-10 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001074

• SIGi001-A-11 / SAMEA4451118 WGS data

  The iPSC line SIGi001-A-11 / SAMEA4451118 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-11 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001075

• SIGi001-A-12 / SAMEA104237570 WGS data

  The iPSC line SIGi001-A-12 / SAMEA104237570 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-12 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001076

• SIGi001-A-2 / SAMEA4451116 WGS data

  The iPSC line SIGi001-A-2 / SAMEA4451116 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-2 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001077

• SIGi001-A-6 / SAMEA4447426 WGS data

  The iPSC line SIGi001-A-6 / SAMEA4447426 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-6 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001078

• SIGi001-A-4 / SAMEA4448632 WGS data

  The iPSC line SIGi001-A-4 / SAMEA4448632 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-4 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001088

• SIGi001-A-5 / SAMEA4448708 WGS data

  The iPSC line SIGi001-A-5 / SAMEA4448708 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-5 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001092

• SIGi001-A-8 / SAMEA4448777 WGS data

  The iPSC line SIGi001-A-8 / SAMEA4448777 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-8 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001093

• SIGi001-A-9 / SAMEA4447499 WGS data

  The iPSC line SIGi001-A-9 / SAMEA4447499 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-9 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001095

• DAC for study "Single-nucleus brain transcriptomics reveals microglia dysfunction in Multiple System Atrophy"

  Dataset containing snRNA-seq samples from MSA or PD patients, and healthy controls. We aimed at identifying molecular processes at the single cell level that could identify common and/or disease-specific differences between healthy controls and patient groups. Frozen tissue samples from healthy controls, and multiple system atrophy or Parkinson's disease patients were excised and single nuclei were isolated following the 10x Genomics Chromium workflow.

  Dac EGAC50000000809

• 10X 3' V2 data of single immune cells in hepatocellular carcinoma

  The immune microenvironment of hepatocellular carcinoma (HCC) is poorly characterized. Combining two single-cell RNA sequencing technologies, we produced transcriptomes of CD45+ immune cells for HCC patients from five immune-relevant sites: tumor, adjacent liver, hepatic lymph node (LN), blood, and ascites. This is the droplet data of this study

  Dataset EGAD00001005961

• Paired-end Whole Exome-seq analysis of multi-centric lower grade glioma

  This dataset includes Nimblegen SeqCap EZ Exome v3 data for each lesion of three patients with multicentric glioma. For two patients, each lesion was sequenced along with whole blood. For a third patient, 3 pieces from the right lesion and 4 pieces from the left were sequenced along with whole blood. In each case BAM files that have been aligned with BWA mem alignment are available.

  Dataset EGAD00001003795

• Paired-WGS-two-families-with-GBA-variants-and-Parkinsons-disease

  We performed whole- genome sequencing, rare variant filtering, segregation analysis and functional validation of PD cosegregating rare genetic variation in two families (6 samples) segregating PD associated GBA variants c.115+1G>A (ClinVar ID: 93445, ) and p.L444P (ClinVar ID: 4288) respectively. The paired WGS sequencing was run on HiSeq X Ten and the library preparation kit was Illumina TruSeq DNA nano.

  Dataset EGAD00001006561

• GELATO clinical trial whole exome sequencing data (primary tumors and local recurrences)

  Paired-end whole exome sequencing of 10 lobular breast cancer primary tumors, 3 local recurrences and matched normal samples obtained from 10 unique patients from the GELATO clinical trial. The included raw sequencing data in fastq format was generated using Illumina NovaSeq 6000 from archived FFPE material (tumor data) and fresh frozen material (matched normal data).

  Dataset EGAD00001009836

• Epigenomic analysis of human dopaminergic neuron differentiation reveals LBX1, NHLH1 and NR2F1/2 as necessary for lineage specification

  Sample information: The 56 samples produced in this project come from the human iPSC line GM17602 (Coriell) where a tyrosine hydroxylase-T2A-mCherry reporter was inserted. A combination of epigenetic analysis (ATAC/ChIP) along transcriptomics.

  Dataset EGAD00001009288

• Exome sequencing of lung tissue conducted in SMC

  The data includes exome sequencing FASTQ files of 335 patients receiving immune checkpoint blockade therapy. The data only provides for WXS of tumor tissue.

  Dataset EGAD00001009101

• Intra-prostatic tumour evolution, steps in metastatic spread and histogenomic associations revealed by integration of multi-region whole genome sequencing with histopathological features

  We performed whole genome sequencing on 42 prostate cancer samples from the prostate, seminal vesicles and regional lymph nodes of five treatment-naive patients with locally advanced disease who underwent radical prostatectomy. Whole genome sequencing was performed as 150bp paired end reads on the Illumina NovaSeq 6000 platform.

  Dataset EGAD00001011174

• WXS Normal Samples Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011321

• lpWGS of solid and liquid samples from female patients with metastatic breast cancer

  low-pass Whole Genome Sequencing (lpWGS) to assess the representativeness of seven body liquids from female patients with metastatic breast cancer. 20 patients. 216 liquid samples, 745 solid samples, 20 matched normal samples. 0.5X coverage. Illumina single read sequencing. Fastq files are provided. lpWGS from Richard et al., Nature Communications, 2025.

  Dataset EGAD50000001851

• Targeted sequencing data on sequential liquid biopsy samples from CSPC patients

  Sequencing data from newly diagnosed high emtastatic burder prostate cancer patients receiving an AR pathway inhibitor (ARPI) or docetaxel. Targeted sequencing data of prostate cancer relevant genes using the PCF-SELECT capture panel. cfDNA from PreADT, baseline, on-treatment (Cycle1 to 6) taken on ARPI or Docetaxel were sequenced as well as patient-matched WBC DNA

  Dataset EGAD50000001960

• Cancer Research UK Manchester Institute/ Cancer Research UK National Biomarker Centre Data Access Committee

  Cancer Research UK Manchester Institute/Cancer Research UK National Biomarker Centre Data Access Committee is created to • Review and approve data access requests. • Ensure data security and compliance with institutional and legal obligations. • Maintain accurate records of access decisions For questions or further information, please contact: Chair of the Data Access Committee: Caroline Wilkinson Email: dac@cruk.manchester.ac.uk

  Dac EGAC50000000795

• RNAseq profiling of pediatric osteosarcoma

  Primary pediatric osteosarcoma samples were collected and profiled using RNAseq. When possible, germline and tumor samples were collected. For some patients, multiple tumor tissues were collected and sequenced. Some of the samples were used to derive PDTX models, which were also profiled with RNAseq. Paired end sequencing was performed on Illumina HiSeq instruments and FASTQ files reported.

  Dataset EGAD00001004538

• Transcriptome and Exome from longitudinal samples of human glioblastoma (newly added after 2015)

  We expanded our previous collection of longitudinal GBM patients (EGAS00001001041) by recruiting 21 additional patients. Tumor specimens were subjected to whole-exome sequencing (16 of 21 cases, with the matched normal/blood) and transcriptome sequencing (16 of 21 cases).

  Dataset EGAD00001002143

• Genomic Profiling of Advanced Pancreatic Cancer to inform therapy - WGS mapped reads

  Genomics-Driven Precision Medicine for Advanced Pancreatic Cancer - Early Results from the COMPASS Trial - WGS mapped reads

  Dataset EGAD00001003585

• Single-nucleus Isoforms of Down Syndrome Brains (long-read)

  16 DS and Control brains samples were prepared using the 10X Genomics Single Cell 3' v3 kit. Pre-fragmented cDNA libraries were loaded onto a Pacific Biosciences Sequel II to sequence single-nucleus isoforms.

  Dataset EGAD00001008286

• 2 10X multiomics (RNA+DNA) gray matter brain controls donors

  Single cell multiomics from 2 donor controls, expression and chromatin accessibility. Samples belong to gray matter tissue from the brain.

  Dataset EGAD00001008457

• DNA methylation-based classification of sinonasal tumors [DNA sequencing]

  This dataset contains raw exome sequencing data from nine sinonasal undifferentiated carcinoma FFPE samples and matched normal tissue that were assigned to a shared epigenetic class using DNA methylation-based classification. They were analyzed using the Twist Human Core Exome Plus Kit (Twist Bioscience) on a NovaSeq 6000 sequencer.

  Dataset EGAD00001009668

• Single-cell whole-genome sequencing dataset of sorted CD3+, CD33+, and CD34+ cells from aplastic anemia

  This dataset contains raw single-cell whole-genome sequencing data generated from a single patient with aplastic anemia using the BioSkryb platform. Single cells were isolated based on surface marker expression (CD3+, CD33+, and CD34+) and subjected to whole-genome amplification followed by sequencing on an Illumina platform.

  Dataset EGAD50000002195

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326