17511 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 37.56 milliseconds.

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• FASTQ Data from In Situ Hi-C on Medulloblastoma Tissue Samples

  29 Hi-C datasets [8 G3 (MB3667, MB3687, MB3690, MB3692, MB3693, MB4010, MB4037, MB4141), 13 G4 (MB0558, MB3510, MB3670, MB3689, MB3716, MB3760, MB3761, MB3807, MB4079, MB4132, MB4174, MBSF7, SNC_2_5), 7 SHH (MB3612, MB3661, MB3662, MB3695, MB3697, MB3724, MB4143), and 1 WNT (MB4036)]. Fresh tissue samples were obtained from The Hospital for Sick Children (Toronto, ON). In situ Hi-C libraries were generated using approximately 2.5 million dissociated cells as input. All Hi-C libraries were sequenced at 150 bp PE with a Hi-Seq X instrument (Illumina) at McGill Genome Centre (Montreal, QC).

  Dataset EGAD50000000771

• 252 human breast cancer samples in WGS and WES

  We analyzed chromothripsis in 252 human breast cancers from two patient cohorts (149 metastatic breast cancers, 63 untreated primary tumors, 29 local relapses, 11 longitudinal pairs) using whole-genome and whole-exome (paired) sequencing. A lot of the WGS samples were sequenced on Illumina HiSeq X-Ten using Illumina TruSeq Nano DNA. For exome sequencing Agilent_SureSelect_V5+UTRs has been used (sequencing on Hiseq2000, Hiseq2500 and Hiseq4000). For exome sequencing Agilent_SureSelect_V5+UTRs has been used (sequencing on Hiseq2000, Hiseq2500 and Hiseq4000).

  Dataset EGAD00001007563

• DDD_1 hypermutated individual

  CRAM files and VCF for DDD_1 and their parents. Also de novo mutations file for hypermutated DDD_1 child as described in the manuscript ‘Genetic and chemotherapeutic influences of germline hypermutation’ by Kaplanis et al. which will be published in Nature shortly.

  Dataset EGAD00001008497

• TIGER samples

  The TIGER samples dataset contains PISA cohort samples which consist of paired RNA-seq and genotyping array data. It contains 127 RNA-seq pair-end samples in fastq format and 127 individuals genotypes in PLINK format.

  Dataset EGAD00001007990

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661

• DKFZ-St.Jude Medulloblastoma - 218 CEF control exomes

  218 control exomes, CEF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006659

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Analysis File for 87 Argentinean individuals

  VCF for 87 Argentinean samples. Only SNPs (no indels) that passed the Affymetrix QC. Data from Luisi et al. 2020. Plos One. Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina. Reference Allele column does NOT contain reference allele from genome assembly.

  Dataset EGAD00001006227

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Expression array

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed.
This dataset contains expression array data for 32 patients of the screening cohort with 8 of them having paired normal tissue plus an additional relapse tumor/normal pair of one of those 8 patients and a patient only with normal tissue. Data was generated on a HumanHT-12 v4 Bead Array (Illumina) and is stored in IDAT file format.

  Dataset EGAD00010002596

• Single-nucleus mRNA-Sequencing of prenatal and postnatal samples from the brain and its border regions

  Single-nucleus mRNA Sequencing of prenatal and postnatal samples from the brain and its border regions. Most samples were multiplexed with several samples run in one 10X reaction. A separate immune cell dataset was combined with published data from Braun et al 2023 and Yang et al 2021 integrated using harmony is included.

  Dataset EGAD50000000044

• ICARUS-BREAST01 Dataset

  A phase II clinical trial (NCT04965766) of patritumab deruxtecan in 99 breast cancer patients. Whole-exome sequencing (WES) is available for 43 tumor samples and 43 blood samples collected at entry into the trial. RNA-squencing is available for 44 samples comprising 22 samples collected at entry into the trial and 22 samples collected during treatment (cycle 1 day 3, cycle 1 day 19, or cycle 2 day 3) from 22 patients.

  Dataset EGAD50000000773

• Transcriptome analysis of patient-derived Schwann cells isolated from human sural nerve biopsies

  This dataset contains the transcriptome analysis of human Schwann cell cultures obtained from sural nerve biopsies from six patients with polyneuropathies (N=3/patient, totalN=18) as well as the nerve fascicles from where they were isolated (N=1/patient, totalN=6). In addition, this dataset includes 8 samples out of commercial human Schwann cell cultures and one sample of a fibroblast culture, which serve as controls for further analysis.

  Dataset EGAD50000001021

• A first-in-human clinical study of an allogenic iPSC-derived corneal endothelial cell substitute transplantation for bullous keratopathy

  iPSC-derived corneal endothelial cell substitutes recover pathological corneal edema. No adverse reactions are observed after one year follow-up. Gene mutations may appear despite whole genome sequencing of the master cell bank. This study contains WGS data.

  Study EGAS50000000672