5032 results for "*oma"

in 74.57 milliseconds.

• Multi-Omic Profiling of Glioma Patient Tumors and Patient-Derived Model Systems

  We have created a resource of transcriptomic (RNAseq), genomic (whole-exome seq), and lipidomic (untargeted shotgun) profiling data from over 175 molecularly diverse glioma tumors and derivative models in orthotopic mouse xenografts and gliomasphere cultures from over 110 unique patient tumor lines. Provided in this dataset are matched bulk RNA and whole-exome paired-end sequencing data from resected gliomas and derived model systems performed on Illumina HiSeq and NovaSeq sequencing instruments. This comprehensive dataset powers multiple studies aiming to derive molecular signatures of intertumoral heterogeneity and perturbation responses in glioma. Through integrative multi-omic analyses in Minami, et al., 2023, PMID: 37236196, we identified that CDKN2A deletion remodels the GBM lipidome and consequently primes CDKN2A-deleted tumors for ferroptosis. Lipidomics data related to this study are publicly available here. In another study, we used a combination of molecular profiling and functional profiling of apoptotic potential to stratify patients into groups with differential vulnerability to the current standard-of-care in gliomas, and in combination with drugs targeting intrinsic apoptosis, largely informed but not limited to TP53 mutation status.

  Study phs003286

• Evolving Cell States and Oncogenic Drivers during the Progression of IDH-Mutant Gliomas

  The study aims to understand the changes in cell states during the progression of IDH mutant gliomas. We generated scATAC-seq data from tumor samples of patients with IDH mutant gliomas, ranging from grade 2 to grade 4, including both IDH mutant oligodendroglioma and IDH mutant astrocytoma samples. Additionally, we have generated scRNA-seq data from patient-derived organoids that were treated with a DNMT1 inhibitor.

  Study phs003697

• Chromothripsis in Small Cell Lung Carcinoma Associated with Carcinoid Transformation

  Small cell lung carcinoma (SCLC) is typically associated with tobacco exposure and inactivation of RB1 and TP53 genes. We performed detailed clinicopathologic, genomic, and transcriptomic profiling of an atypical subset of SCLC in never/light smokers that lacked RB1 and TP53 co-inactivation and found that most cases were associated with chromothripsis – massive, localized chromosome shattering, recurrently involving chromosomes 11 or 12, among other findings. Uniquely, these clinically aggressive tumors exhibited genomic and pathologic links to pulmonary carcinoids. Conversely, SCLC never smokers harboring inactivated RB1 and TP53 exhibited hallmarks of adenocarcinoma-to-SCLC derivation, supporting two distinct pathways of plasticity-mediated pathogenesis of SCLC in never smokers.

  Study phs003676

• The Somatic Mutational Landscape of Thyroid Cancer in Patients with Germline PTEN Mutations

  PTEN hamartoma tumor syndrome (PHTS) is associated with a high rate of thyroid cancer and benign thyroid disease, yet nothing is known of the genomic landscape of PHTS-associated thyroid tumors. In this study, exome sequencing was performed on 58 thyroid tumors (28 cancers, 30 benign nodules) from 19 patients with PHTS, sequenced in tumor-normal pairs. Somatic variant calling was utilized to determine the somatic mutational landscape of thyroid tumors in this population. This was then compared to the known mutational landscape of sporadic thyroid cancer in the general population using sequencing data from The Cancer Genome Atlas. The primary finding of the study was that PHTS-associated thyroid tumors had a unique genomic landscape, including a high frequency of second-hit somatic PTEN alterations compared to the sporadic thyroid tumors. Additionally, PHTS-associated thyroid cancers were found to have somatic alterations in BRAF, RAS family members, and genes associated with DNA double stranded break repair. Data available through dbGAP will include tumor BAM files for each tumor, normal BAM files for each patient, and MAF files for PHTS-associated thyroid cancer and PHTS associated benign thyroid nodules.

  Study phs003640

• Phase 2 Study of Nivolumab and Entinostat in Unresectable or Metastatic Cholangiocarcinoma and Pancreatic Adenocarcinoma

  The study was a single-center, open-label, phase II trial (registration no. NCT03250273) designed to evaluate the efficacy of entinostat in combination with nivolumab in patients with advanced pancreatic ductal adenocarcinoma (PDAC). The aim was to assess the objective response rate using RECIST v1.1 criteria as the primary endpoint. A total of 27 patients with advanced PDA were enrolled from November 2017 to November 2020. Their treatment involved a 14-day lead-in with entinostat monotherapy, followed by a combination with nivolumab. The study utilized several molecular technologies to assess immune profiles and tumor microenvironment (TME) changes: high-dimensional mass cytometry by time of flight (CyTOF), Luminex for chemokine analysis in plasma, multiplexed immunohistochemistry (mIHC), image cytometry-based quantification, bulk RNA sequencing analysis. The objective response rate (ORR) was 11% with three patients showing a partial response (PR). The median duration of response was 10.2 months. Grade ≥ 3 treatment-related adverse events (TRAEs) occurred in 63% of patients, with the most common being decreased lymphocyte count, anemia, hypoalbuminemia, and hyponatremia. Gene expression analysis showed an enrichment in inflammatory response signaling pathways with the combination treatment. RNA sequencing data with clinical and demographic patient information will be available through dbGaP. For expression summaries, please refer to GEO submission GSE248014.

  Study phs003615

• Clinical Outcomes and ctDNA Correlates for CAPOX BETR: A phase II trial of Capecitabine, Oxaliplatin, Bevacizumab, Trastuzumab in Previously Untreated Advanced HER2+ Gastroesophageal Adenocarcinoma

  We performed circulating tumor DNA (ctDNA) analysis on plasma of patients with advanced HER2 positive gastroesophageal adenocarcinomas who were treated on a phase 2 clinical trial testing the addition of bevacizumab to capecitabine, oxaliplatin, and trastuzumab. ctDNA was analyzed using panel based next generation sequencing assay (Predicine CARE), low-pass whole genome sequencing (LP-WGS), and methylation based panel assay (Predicine ALERT). This allowed us to derive tumor mutational profiles, circulating tumor fractions in plasma, and changes in both over time. We show that tumor fraction and the presence of mutations in the MAPK pathway are prognostic in our patient cohort. LP-WGS data from baseline and cycle 2 of treatment is available through dbGaP. Additional data is submitted alongside the manuscript.

  Study phs003706

• Genomic Analysis of Diffuse Large B Cell Lymphoma

  Tumors from 383 newly diagnosed diffuse large B cell lymphoma were included in this study. Tumor DNA was extracted from formalin-fixed, paraffin embedded (FFPE) tissue sections, germline DNA was extracted from blood, and whole exome sequencing (WES) of all samples (n=340 tumor normal pairs) was performed using the Agilent SureSelect XT AllExon v5 + UTR kit and sequencing was carried out on an Illumina NovaSeq, 100 x 2 paired end reads. Tumor RNA (n=321) was extracted from formalin-fixed, paraffin embedded (FFPE) tissue sections and RNA sequencing was performed using the Illumina TruSeq RNA Exome Kit (Illumina) for library preparation, sequencing platform HiSeq 4000, 100 x 2 paired end reads.

  Study phs003634

• Single Cell RNA-Seq Reveals Malignant and Stromal Programs Associated with Metastasis in Head and Neck Cancer

  This study of head and neck cancer aimed to profile individual malignant, stromal, and immune cells in treatment-naive oral cavity squamous cell carcinoma, with or without matched metastatic cervical lymph nodes. Clinical and pathologic information was collected on all patients, in addition to a fresh biopsy sample from the primary tumor and/or metastatic lymph node at the time of initial surgery. Biopsy specimens were processed for single cell RNA-seq (scRNA-seq) and/or whole exome sequencing (WES). A total of ~6,000 single cells from 18 participants were included in the final dataset. Stromal and immune cells had consistent expression programs across patients. Conversely, malignant cells varied within and between tumors in their expression of signatures related to cell cycle, stress, hypoxia, epithelial differentiation, and partial epithelial-to-mesenchymal transition (p-EMT). One of the top scoring genes in this program was TGFβ-induced (TGFBI), implicating the classic EMT regulator TGFβ. Cells expressing the p-EMT program spatially localized to the leading edge of primary tumors. By integrating single-cell transcriptomes with bulk expression profiles for hundreds of tumors, we refined Head and Neck Squamous Cell Carcinoma (HNSCC) subtypes by their malignant and stromal composition, and established p-EMT as an independent predictor of nodal metastasis, grade, and adverse pathologic features. Our results provide insight into the HNSCC ecosystem and define stromal interactions and a p-EMT program associated with metastasis.

  Study phs001474

• Gene Variants in Pheochromocytoma and Paraganglioma

  Pheochromocytoma and paraganglioma (PPGL) are rare neuroendocrine tumors that arise from chromaffin cells in the adrenal medulla and in extra-adrenal locations, respectively. PPGL has the strongest hereditary risk of all endocrine neoplasms with about 40% of cases harboring germline mutations and another 25-30% of cases arising from somatic mutations. To date, over 20 susceptibility genes have been suggested to play a role in PPGL pathogenesis, with more genes still being researched. This project will seek to identify new candidate genes in apparently sporadic PPGLs to reveal a possible genetic background in cases without variants in known susceptibility genes. Knowledge of the genetic background and the genes involved in the pathogenesis of PPGL allows for clustering and/or development of targeted therapies for the tumors that cannot be surgically resected or tumors that have metastasized.

  Study phs002405

• Comprehensive Genomic Data Deposition for Pancreatic Cancer Precision Medicine Studies: Clinical Trials NCT02451982 and NCT02648282

  This submission includes specimens from 89 pancreatic cancer patients at Johns Hopkins Hospital, comprising 41 surgically resectable and 48 locally advanced pancreatic cancer (LAPC) cases. These samples originate from two clinical studies, NCT02451982 and NCT02648282, following the Johns Hopkins Medical Institution Institutional Review Board-approved registry protocol at the Pancreatic Cancer Precision Medicine Center of Excellence Program. Written consent for specimen use, obtained from participants in the original studies, covers additional research, including this one. Biopsy specimens collected through endoscopic ultrasound-guided fine needle core biopsies or surgically resected tumors are included. NCT02451982 is a platform trial evaluating immunotherapy combinations for surgically resectable pancreatic ductal adenocarcinoma in the neo-adjuvant and adjuvant settings. It investigates the GVAX pancreatic cancer vaccine with immune-boosting cyclophosphamide, exploring immune cell trafficking and the impact of PD-1 blocking. NCT02648282 focuses on the efficacy and safety of combining cyclophosphamide, pembrolizumab, GVAX, and stereotactic body radiotherapy (SBRT) in locally advanced pancreatic cancer, with an emphasis on anti-tumor activity. Both studies provide valuable insights into innovative pancreatic cancer treatment approaches.

  Study phs003600

• Pre-Existing Skin-Resident CD8 and γδ T Cell Circuits Mediate Immune Response in Merkel Cell Carcinoma and Predict Immunotherapy Efficacy

  Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer with a ~50% response rate to immunotherapy. Here, we attempted to identify novel predictive biomarkers of response through extensive and deep multi-omics interrogation of 186 samples from 116 patients. We collectively integrated bulk RNAseq, single-cell RNAseq, multiplex immunofluorescence, and spatial transcriptomics. Importantly, we were also able to study 14 matched pairs of tissue samples from pre- and post-immunotherapy. In non-responders, tumors show evidence of increased tumor cell cycling, expression of neuronal stem cell markers, and IL-1α/β. Responders have evidence of increased type I/II interferon signatures and evidence of pre-existing tissue resident (Trm) CD8 or Vδ1 γδ T cells that functionally converge with overlapping antigen-specific transcriptional programs and clonal expansion of multiple T cell receptors. Spatial transcriptomics demonstrated higher co-localization of T cells with B and dendritic cells in responders, with evidence of expression of chemokines important for co-stimulation. Finally, immunotherapy increased clonal expansion or recruitment of Trm and Vδ1 cells in tumors in responders, further underscoring their therapeutic importance. These data identify potential novel actionable biomarkers and therapeutic targets for MCC.

  Study phs003629

• Single-Cell Analysis of the Multiple Myeloma Microenvironment after Gamma-Secretase Inhibition and CAR T-Cell Therapy

  We examined the effects of gamma-secretase inhibition (GSI) on the bone marrow microenvironment in multiple myeloma patients before anti-B-cell maturation antigen (BCMA) CAR T-cell therapy. Single-nuclei RNA and ATAC sequencing revealed significant changes in gene expression and chromatin accessibility, especially in monocytes and tumor cells, following exposure to GSI. The findings suggest that GSI influences not only BCMA signaling but also broader cellular interactions within the tumor microenvironment. De-identified sequencing data from the study is available through dbGaP.

  Study phs003741

• The Genetic Evolution of Acral Melanoma

  Acral melanoma is a rare melanoma subtype arising on the sole, palm, or nail apparatus. We performed whole-exome sequencing (WES) for a cohort of 35 acral melanoma patients. For each patient, we sequenced multiple tumor areas representing different tumor stages, including the in situ and invasive portions of the primary tumor and available regional or distant metastases. Normal areas were included for all except one patient. We identified distinct evolutional trajectory compared to melanomas arising on the sun-exposed skin. Whole-genome sequencing and targeted sequencing were additionally performed for a subset of the samples. Particularly, in acral melanomas, complex genomic aberrations, characterized by clustered copy number transitions and focal amplifications, and telomerase reverse transcriptase (TERT) activating alterations occur very early during evolution, while MAP-kinase pathway mutations, such as BRAF V600E and NRAS hotspot mutations, can occur late and often result in striking intra-tumor heterogeneity.

  Study phs003451

• Whole Exome Sequencing of Head and Neck Patients-Derived Tumor Organoids and Formalin Fixed Paraffin Embedded Tumor Tissue

  In this study, tissue specimens were procured from head and neck squamous cell carcinoma (HNSCC) patients undergoing routine diagnostic procedures as part of their standard of care. For surgical cases, only excess tissue remaining after allocation for essential pathological diagnosis was utilized for research purposes. We aimed to validate the genomic fidelity of patient-derived organoids (PDOs) compared to their originating tumors. Whole exome sequencing was performed on four paired sets of PDOs and matched surgical specimens preserved as formalin-fixed paraffin-embedded (FFPE) samples. The objective was to demonstrate that the in vitro PDO models maintain the genomic profile of the patient-specific tumors, thus supporting their potential application in identifying efficacious personalized treatment regimens. Comparative analyses of single nucleotide variants (SNVs) and copy number variants (CNVs) between matched PDO and FFPE pairs were conducted to assess global genomic similarity and shared HNSCC-relevant variants. The results indicated that the PDOs closely recapitulated the mutational landscape of the resected tumors from which they were derived. This finding supports the validity of the employed in vitro culture conditions for potential use in precision medicine approaches for HNSCC. The data submitted to dbGaP comprise eight whole exome sequencing profiles of matched pairs of HNSCC FFPE and PDO samples from four subjects. Novogene (Novogene Co., Ltd, CA, USA) generated these profiles from 1.0μg genomic DNA per sample, using the Agilent SureSelect Human All Exon kit (Agilent Technologies, CA, USA). Deposited files include raw BAM files of reads aligned to human genome Hg19 using BWA (v.0.7.8-r455), sorted with Samtools (v1.0), and filtered for duplicate reads using Picard (v1.111). Additionally, we've deposited VCF files of SNV variant calls from GATK (v3.8).

  Study phs003755

• Transgenerational Transmission of Post-Zygotic Mutations Suggests Symmetric Contribution of First Two Blastomeres to Human Germline

  Skin and blood samples were collected from four phenotypically normal individuals (mother, father, and children) from a randomly selected family. Whole genomes of the samples from these individuals were sequenced to a depth of 30X-200X. Sequencing data for the mother was previously analyzed and is available at NDA collection #2961. Sequenced reads from the children and father were aligned to the human reference genome (hg19) generating BAM files for each individual. We used post-zygotic mutations in the mother to trace cell lineages across human generations. Analysis of this family demonstrated that different cell lineages were transmitted to offspring. Coupled with analysis of publicly available data, this result revealed a fundamental difference between soma and germline in lineage allocation and suggested a 50:50 contribution of the first two blastomeres to the germline.

  Study phs003781

• DAC Longitudinal Multi-Omics Study Reveals Molecular Drivers and Tumor Microenvironment in Extramedullary Multiple Myeloma

  Data access requests for the raw data used in publication "Longitudinal Multi-Omics Study Reveals Molecular Drivers and Tumor Microenvironment in Extramedullary Multiple Myeloma"

  Dac EGAC50000000016

• Mechanisms of duodenal adenoma development in familial polyposis syndromes

  Study EGAS00001006561

• UAMS - Myeloma Institute Data Access Committee

  Dac EGAC00001000845

• DAC of the STIC project

  Ovarian high-grade serous carcinoma (HGSC) originates in the fallopian tube, with secretory cells carrying a TP53 mutation, known as ‘p53 signatures’, identified as potential precursors. p53 signatures evolve into serous tubal intraepithelial carcinomas (STIC) lesions, which, in turn, progress into invasive HGSC that readily spread to the ovary and disseminate around the peritoneal cavity. We recently investigated the genomic landscape of early- and late-stage HGSC and found higher ploidy in late-stage (median 3.1) than early-stage (median 2.0) samples. Here, to explore whether the high ploidy and possible whole genome duplication observed in late-stage disease are determined early in the evolution of HGSC, we analysed archival formalin-fixed paraffin-embedded samples (FFPE) from five HGSC patients. p53 signatures and STIC lesions were laser-capture microdissected and sequenced using shallow whole genome sequencing (sWGS), while invasive ovarian/fallopian tube and metastatic carcinoma samples underwent macrodissection and were profiled using both sWGS and targeted next generation sequencing. Results showed highly similar patterns of global copy number change between STIC lesions and invasive carcinoma samples within each patient. Ploidy changes were evident in STIC lesions, but not p53 signatures, and there was strong correlation between ploidy in STIC lesions and invasive ovarian/fallopian tube and metastatic samples in each patient. The reconstruction of sample phylogeny for each patient from relative copy number indicated that high ploidy, when present, occurred early in the evolution of HGSC, which was further validated by copy number signatures in ovarian and metastatic tumours. These findings suggest that aberrant ploidy, suggestive of whole genome duplication, arises early in HGSC, and is detected in STIC lesions, implying that the trajectory of HGSC may be determined at the earliest stages of tumour development.

  Dac EGAC50000000227

• Paediatric neuroblastoma long-read whole genome sequencing dataset

  Dac EGAC50000000221

• MD Anderson Lymphoma & Myeloma Data Access Committee

  Dac EGAC00001002706

• DAC for "Cancer-associated fibroblasts promote drug resistance in ALK-driven lung adenocarcinoma cells by upregulating lipid biosynthesis"

  DAC for the data of "Cancer-associated fibroblasts promote drug resistance in ALK-driven lung adenocarcinoma cells by upregulating lipid biosynthesis" with: • Holger Sültmann • h.sueltmann@dkfz.de • German Cancer Research Center (DKFZ) • Ann-Kathrin Daum • a.daum@dkfz.de • German Cancer Research Center (DKFZ)

  Dac EGAC50000000076

• DAC for Breast Invasive Lobular Carcinoma CDH1 study

  We developed an artificial intelligence (AI)-model applied to histological images trained using CDH1 biallelic mutations, pathognomonic for breast invasive lobular carcinoma (ILC), as ground truth. We evaluated the performance of the AI-model to predict the presence of CDH1 biallelic mutations and to diagnose ILC. Subsequently, we investigated the molecular underpinning of cases predicted by the model to harbor a CDH1 biallelic mutations but lacking these alterations according to targeted sequencing. We then subjected one ILC lacking CDH1 biallelic mutations and lacking CDH1 promoter methylation to whole genome sequencing (WGS) to determine the molecular basis of its lobular phenotype.

  Dac EGAC50000000333

• Medulloblastoma Hi-C Data Access Committee

  Contact Information Marco Gallo marco.gallo@bcm.edu

  Dac EGAC50000000357

• UniKilinikum Wuerzburg MSNZ AGRasche/AG Riedel EMD DAC

  This is a Data access committee for the Data presented in the paper tilted "Spatially resolved transcriptomics reveals profound subclonal heterogeneity and T cell dysfunction in extramedullary myeloma"

  Dac EGAC50000000173

• Contribution of specific cell types to the development of Barrett’s esophagus and carcinoma via germline genetic risk

  We sought to elucidate how individual cell types in Barrett’s esophagus (BE) and esophageal adenocarcinoma (EAC) contribute to disease development via germline genetic risk.

  Dac EGAC50000000235

• Berlin Neuroblastoma single-cell DAC

  Dac EGAC50000000347

• DAC for a single-cell multi-omic atlas of nodal B-cell non-Hodgkin lymphomas

  Nodal B-cell non-Hodgkin lymphomas (B-NHL) are a clinically diverse set of cancers thought to originate from distinct stages of B-cell maturation. To characterize intratumor heterogeneity across B-NHL entities, we performed CITE-Seq (cellular indexing of transcriptomes and epitopes) on 51 lymph node samples including mantle cell lymphoma (MCL, n = 8), follicular lymphoma (FL, n = 12), germinal center (GCB, n = 5) or activated B-cell (non-GCB/ABC, n = 7) diffuse large B-cell lymphoma (DLBCL) and marginal zone lymphoma (MZL, n = 11) tumors, in addition to non-malignant reactive lymph nodes (rLN, n = 8). We also performed 5 prime scRNA-seq with immune receptor profiling for 11 of these samples (2 rLN, 2 MCL, 3 FL, 2 DLBCL, and 2 MZL).

  Dac EGAC50000000226

• Testicular large B-cell lymphoma is genetically similar to PCNSL and distinct from nodal DLBCL

  Next generation sequencing (NGS) data analyzed in Rivas-Delgado, López, et al. HemaSphere 2024. Single nucleotide variants (SNVs) and short insertions /deletions (indels) were evaluated in 42 samples using a B-cell malignancy-oriented targeted panel covering 115 genes (SureSelectXT, Agilent Technologies and sequenced in a MiSeq instrument (Illumina; 2x150bp; mean coverage of 599x). The NGS data of 39 samples is provided here. The 3 additional samples were previously published. Please, see the original publication for additional details.

  Study EGAS50000000521

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma samples (99 FFPE tumor tissue derived DNA and 9 circulating tumor DNA) and corresponding germline DNA of 38 controls. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dac EGAC50000000261

• Association of Oxidative Stress Pathway Alterations with Risk of Treatment Failure in RTOG9512: A Randomized Trial of Hyperfractionation Versus Conventional Fractionation in T2 Squamous Cell Carcinoma of the Vocal Cord

  Based on the growing body of retrospectively collected and heterogeneously treated clinical cohorts and preclinical models, we investigated the clinical importance of NRF2 pathway alteration in an independent set of patients treated uniformly in the large prospective phase III trial RTOG 9512. We tested the hypothesis that patients with T2 glottic squamous cell carcinoma (SCC) harboring NRF2 pathway mutations would show radioresistance and have more local failure (LF) and locoregional failure (LRF) compared to those who did not have these mutations, using patients who received radiotherapy alone, thus removing potentially confounding effects of other therapies, like surgery or chemotherapy.

  Study phs003274

• Gabriella Miller Kids First Pediatric Research Program in Enchondromatoses and Related Malignant Tumors

  Chondrosarcoma is a malignant tumor that originates from cartilaginous cells. It is the third most common primary malignancy of bone after myeloma and osteosarcoma. It accounts for about 20% of bone tumors and is diagnosed in approximately 600 patients each year in the United States. Up to 40% of the chondrosarcomas arise from an enchondroma. Enchondromas are benign, intramedullary cartilaginous tumors of bone. They can be solitary or multiple and are present in >3% of the population. Enchondromatosis refers to a group of diseases characterized by multiple enchondromas including metachondromatosis (MC), Ollier disease (OD), and Maffucci syndrome (MS) among others. All have skeletal abnormalities with or without associated vascular anomalies that can cause severe limb deformities during early childhood. The risk for chondrosarcoma is up to 30% in OD and MS. Currently, the only treatment for patients with these disorders is surgical; there is no effective pharmacologic therapy. The molecular bases of these two conditions is not well understood.

  Study phs001987

• RNA sequencing data from glioblastoma primary cell lines treated with indisulam data access committee

  Four glioblastoma primary cell lines (BT592/pt1, BT1007/pt2, BT1009/pt3; BT1012/pt4) were derived from glioblastoma Cavitron Ultrasonic Aspirator (CUSA) material and cultured as neurospheres (GB-NS) in DMEM/F12+Glutamax medium containing B27 supplement (Thermofisher, Waltham, MA, USA) and the mitogenic factors epidermal growth factor (EGF) and fibroblast growth factor b (bFGF) (Peprotech, Rocky Hill, NJ, USA). GB-NS were confirmed mycoplasma-free by PCR Test. Cells were seeded in triplicate in 6-well plates, treated with 5 μM indisulam (Sigma Aldrich, Merk), or vehicle control, and collected after 6 and 16 hours for RNA extraction. Total RNA was extracted using TRIzol Reagent (Life Technologies, Thermo Fisher, cat n. 15596026), RNeasy Mini Kit, and RNase-Free DNase Set (Qiagen, cat n. 74104 and 79254). Sample QC, RNA library preparations, and sequencing reactions were conducted at GENEWIZ (Germany GmbH). The concentration of RNA was quantified using a Qubit Fluorometer (Life Technologies, Carlsbad, CA) and RNA integrity was assayed using a TapeStation. Sequencing libraries were prepared with RNA with PolyA selection and ERCC spike-in with standard ERCC kit (ERCC RNA Spike-In Mix,Thermo Fisher 4456740). Final libraries (Illumina, RNA with PolyA selection) were sequenced on a NovaSeq platform, producing 2×150 base paired-end reads.

  Dac EGAC50000000407

• Multi-omics analysis of pre-invasive lung adenocarcinoma in never-smokers

  Multi-omics analysis of pre-invasive lung adenocarcinoma in never-smokers

  Dac EGAC50000000385

• Single-Cell Transcriptomic Analysis of Kaposi Sarcoma

  Summary: Single-cell transcriptome analysis of skin and blood samples from individuals with Kaposi's sarcoma Aims: Elucidate the cellular composition and gene expression profiles of Kaposi sarcoma herpesvirus (KSHV) infected cells and non-infected tumor infiltrating cells, and peripheral blood samples from the same individuals, with or without specific therapies, such as antiretroviral therapy for HIV, immunotherapies (such as immune checkpoint inhibitors and immune modulator drugs like pomalidomide), or angiogenesis inhibitory agents. Population: Age 18 and older, both genders, including individuals from North America and other areas of the world (including Africa). Individuals with or without HIV are included. Molecular Technologies: Single-cell RNAseq using 10x Genomics Principal Findings: Two distinct populations of endothelial cells were found infected with KSHV, one CD34+ and one CD34-Both clusters include lytic and latent KSHV gene expressionThe KSHV infected cell clusters differ in expression of housekeeping genes, proliferative markers, ribosomal and secretory vesicle genesBiomarkers of KSHV infected cells were identified, including sodium channel SCN9A Changes in cell composition with therapy are noted Clonal amplification of TCR+ T-cells were noted in the skin and blood Data Available through dbGaP: scRNA-seq data

  Study phs003800

• The Melbourne Urological Research Alliance (MURAL) Collection of Patient-Derived Models of Prostate Cancer

  1. Low-Dose Carboplatin Modifies the Tumor Microenvironment to Augment CAR T Cell Efficacy in Human Prostate Cancer Models.Single-cell RNA sequencing (scRNA-seq) was performed to analyze the transcriptional modifications in the tumor microenvironment of prostate cancer patient-derived xenografts (PDX). The analyzed PDX tumor was PDX-287R from the MURAL collection of PDXs (PMID: 34413304). Mice harboring PDX tumors were treated with the carboplatin chemotherapy, and tumors were harvested 3 weeks later. RNA sequencing (RNA-Seq) was used to define immune and non-immune cell populations and anti-tumor innate immune signaling within the tumor microenvironment.To investigate the response of tumor cells to carboplatin treatment in more detail, RNA-Seq was performed on FACs-isolated tumor cells from PDX-287R at one week post-treatment. Gene set enrichment analysis showed an enrichment for apoptotic pathways, with significantly increased expression of the pro-apoptotic genes FAS, BAX, BBC3, IFI6, and JUN. Previously, carboplatin has been shown to activate the cGAS/STING pathway, and here we also found an increase in STING signaling, with an enrichment for the cytosolic DNA sensing pathway and increased expression of STING1, STAT1 and STAT2. There was also a significant increase in the expression of genes involved in T cell chemotaxis, including CXCL10, CXCL11, and CCL20. Collectively, carboplatin-induced cell death in tumor cells likely initiated a pro-inflammatory phenotype in prostate cancer PDXs.2. Co-Targeting BET, CREBBP, and EP300 Inhibits Neuroendocrine Signaling in Androgen Receptor-Null Prostate Cancer.The landscape of castration-resistant prostate cancer (CRPC) is characterized by a multitude of phenotypes, among which neuroendocrine disease holds a prominent position, each displaying unique responses to therapeutic interventions. The efficacy of inhibitors targeting BET and CREBBP/EP300 in prostate cancer treatment is widely acknowledged, primarily due to their ability to attenuate androgen receptor (AR) signaling. However, the effectiveness of these inhibitors in prostate cancers devoid of AR remains uncertain.This investigation sought to elucidate the role of BRD4, CREBBP, and EP300, which are co-expressed in both AR-positive and AR-null prostate cancer. Our study revealed that a compound targeting all three proteins, NEO2734, exhibited efficacy in suppressing the growth of organoids from both AR-positive and AR-null tumors, as evidenced by alterations in viability, size, and cellular composition. Furthermore, NEO2734 treatment consistently led to transcriptional downregulation of cell cycle pathways across various models. In the context of neuroendocrine prostate cancer (NEPC), NEO2734 demonstrated notable efficacy. Treatment with NEO2734 resulted in decreased expression of ASCL1 and other neuroendocrine markers (including SYP) , accompanied by a reduction in tumor growth in vivo. These findings collectively underscore the potential of epigenome-targeted inhibitors in impeding the growth of neuroendocrine prostate cancer, by disrupting lineage regulators in a phenotype-dependent manner. Consistent with the NEPC organoids and explants, NKX3-1 was upregulated in NEO2734-treated PDXs.In this study, we examined the impact of NEO2734 treatment on 6 organoids (treated for 24 hrs), 3 explants treated with JQ1 (for 48 hrs) and 2 PDXs (at two time points) using bulk RNA sequencing (RNA-Seq). These results are available through this dbGaP submission. The implications of these results warrant further exploration and development of compounds possessing similar activities for clinical applications. The ability of NEO2734 to mitigate the growth of both AR-positive and AR-null prostate cancer underscores its potential as a versatile therapeutic agent. Moreover, its efficacy in targeting neuroendocrine phenotypes offers promising avenues for addressing a subtype of CRPC that poses significant clinical challenges. In conclusion, this study sheds light on the intricate interplay between epigenetic regulators and prostate cancer phenotypes. The observed effects of NEO2734 on growth inhibition and phenotype-specific disruption highlight the importance of continued research into compounds with similar epigenome-targeting mechanisms for advancing precision medicine approaches in the treatment of prostate cancer.3. Defining Focal Neuroendocrine Differentiation as a Transcriptionally Distinct Form of Prostate Cancer Pathology Characterized by the Expression of Androgen ReceptorsThe study aimed to understand the transcriptional differences among different neuroendocrine pathologies of prostate cancer. The study hypothesized that the diverse neuroendocrine pathology observed in prostate might be attributable to differences in transcriptional level that remain hidden in bulk RNA-Seq data. To investigate, we employed scRNA-seq to generate gene expression profiles of 18,632 individual tumor cells from 9 PDX models representing five distinct neuroendocrine pathologies of prostate cancer. Our analysis identified 3-8 transcriptionally distinct sub-populations per PDX. The expression of key oncogenic signaling pathways and master regulator activity varied across in neuroendocrine pathologies, with each type of pathology displaying a unique set of transcriptional sub-populations. We discovered that, like the amphicrine pathology, focal neuroendocrine differentiation (focal NED) cells maintain androgen receptor (AR) signaling. However, the expression profiles of focal NED cells differed from the other pathologies, indicating it should be considered as a distinct type of neuroendocrine pathology in prostate cancer. Analysis of copy number alterations suggested little clonal divergence between focal NED cells and neighboring adenocarcinoma cells, emphasizing the transcriptional distinctiveness of focal NED.Overall, the findings suggest potential differences in treatment approaches for tumors from prostate cancer patients showing neuroendocrine pathology, especially focal NED.4. Reprogramming of Androgen Receptor Activity in Castration-Resistant Prostate Cancer is Shaped by Truncated Variants.Under the influence of treatments that target the androgen receptor (AR) axis, prostate cancer cells undergo various changes to the AR gene. This includes the production of truncated AR variants that lack the ligand binding domain and are constitutively active. However, the exact role of these truncated variants in shaping the AR signaling axis and their importance in therapy resistance is not yet fully understood. By examining the AR cistrome in a group of patient-derived prostate cancer models with different mechanisms of castration resistance, we observed diverse changes in AR activity in metastatic prostate cancer, including castration-resistant models. Specifically, we identified a unique subset of tumors characterized by the expression of ARv567es, a variant resulting from structural rearrangements of the AR gene. Tumors positive for ARv567es showed a distinct AR binding profile and epigenome compared to those without ARv567es, which was linked to an altered transcriptional profile. The presence of ARv567es is associated with poor responses to treatments, such as castration and bipolar androgen therapy (BAT), regardless of the presence of full-length AR. This involves disruption of the autoregulatory loop that controls AR gene transcription and reduced transcriptional responses to treatment. Overall, this study demonstrates that ARv567es can lead to transcriptional reprogramming in advanced prostate cancer and drive therapy resistance. 5. The MURAL Collection of Prostate Cancer Patient-Derived Xenografts Enables Discovery Through Preclinical Models of Uro-Oncology.We created a comprehensive PDX resource for prostate cancer to facilitate the rapid and systematic evaluation of new therapies. This collection includes 59 tumors from 30 patients, gathered between 2012 and 2020, aligning with the availability of abiraterone and enzalutamide in the clinic. The PDXs cover the clinical, pathological, and genomic spectrum of prostate cancer, ranging from treatment-naïve primary tumors to castration-resistant metastases. We characterized heterogeneity in adenocarcinoma and neuroendocrine phenotypes using bulk and single-cell RNA sequencing. Additionally, organoids were cultured from PDXs, enhancing our preclinical study capabilities. Employing a 1x1x1 design, we quickly identified tumors with responses to combination therapies. To manage the distribution of PDXs, we established the Melbourne Urological Research Alliance (MURAL). This PDX collection significantly enhances our ability to test and prioritize effective treatments for future clinical trials in prostate cancer.6. Prostate Cancer Associated Fibroblasts Have Distinct Morpho-Mechanical Features That Are Associated With Patient Outcome.The tumor stroma, including cancer-associated fibroblasts (CAFs), has a crucial role in tumor progression. This study focused on the morphological and mechanical properties of CAFs and normal prostatic fibroblasts. The findings revealed that CAFs had distinct morphological and mechanical characteristics compared to normal fibroblasts, such as differences in nuclear size, shape, F-actin arrangement, cellular volumes, and elasticity. Additionally, the study correlated these biophysical properties with transcriptomic data, identifying pathways and cellular components linked to the observed changes. Overall, high-throughput assessments of biophysical properties in prostate cancer cells and stromal components may serve as predictive tools for patient outcomes and help identify new therapeutic approaches targeting the tumor stroma.

  Study phs003369

• Total RNA-Sequencing of patient-derived xenograft models of myxoid liposarcoma

  Study EGAS00001004901

• The Role of E2F4 in Controlling Resistance to Irinotecan (CPT-11) in Human Colon Cancer

  This study reports the results of RNA sequencing (RNA-seq) experiments performed on three isogenic clones of the human HT29 colon cancer cell line, genetically engineered to achieve the selective inactivation of the adenovirus early 2 (E2) gene transcription factor 4 (E2F4) protein, a key functional component of the multimeric transcriptional repression complex known as the dimerization partner (DP), retinoblastoma-like (RB-like), E2F and multi-vulva class B (MuvB) complex (DREAM). In previous studies, we identified E2F4 as a key regulator of colorectal cancer (CRC) resistance to irinotecan (CPT-11), a cytotoxic agent that stands at the backbone of multiple chemotherapy regimens for the treatment of metastatic CRCs. The molecular mechanisms linking E2F4 to irinotecan resistance, however, remain poorly understood. The present study was designed to identify which genes are under the transcriptional control of E2F4, either at baseline or following exposure to SN38 (i.e., the active metabolite of irinotecan, generated in vivo by biotransformation in the liver) in order to clarify the role played by E2F4 in shaping colon cancer resistance to chemotherapy. The cell line used for this study (HT29) is aneuploid and contains three copies of the E2F4 gene, because of a trisomy of chromosome 16, where the E2F4 gene is located (Kawai et al., Genes, Chromosomes & Cancer, 34:1-8, 2002; PMID: 11921276). HT29 cells were infected with lentivirus vectors encoding for CRISPR/Cas9 constructs designed to selectively inactivate the E2F4 gene, using three distinct guide-RNAs (gRNAs), each targeting a different sequence within the proximal exons of the E2F4 gene (exon 1, exon 2). Lentivirus-infected cells were sub-cloned by single-cell fluorescence-activated cell sorting (FACS), based on the differential expression of a fluorescent reporter (EGFP) expressed in tandem with the gRNAs. Isogenic clones (EGFP+) were then screened to identify those with a tri-allelic knock-out, as revealed by both genetic sequencing of the E2F4 gene (revealing the presence of three distinct frameshift mutations) and Western blot (revealing complete loss of E2F4 protein expression). The study includes twelve (n=12) RNA-seq experiments, representative of 3 experimental replicates (i.e., three distinct isogenic clones of the HT29 cell line, each displaying complete loss of E2F4 expression) and 3 negative controls (i.e., three independent preparations of the parent HT29 cell line, infected with a lentivirus vector encoding for a non-targeting gRNA) exposed to 2 distinct in vitro cell culture conditions: a) treatment with SN38 resuspended in dimethyl sulfoxide (DMSO); or b) treatment with DMSO alone (negative control). The in vitro treatment regimen used for SN38 (32 nM, 24 hours) was designed so that the exposure to SN38 experienced in vitro by HT29 cells would mirror the exposure to SN38 experienced in vivo by malignant tissues, as measured, for example, in metastatic CRC patients receiving a standard dose of irinotecan (180 mg/m2) administered by intravenous infusion over 90 minutes (Deyme et al., Cancer Chemotherapy and Pharmacology, 88:247-258, 2021; PMID: 33912999).

  Study phs003560

• Temporal Evolution Reveals Bifurcated Lineages in Aggressive Neuroendocrine Small Cell Prostate Cancer Trans-Differentiation

  Trans-differentiation from adenocarcinoma to small cell neuroendocrine (SCN) cancer is an adverse consequence of treatment escape in various cancers, including prostate, lung, and bladder cancers (Balanis and Sheu et al., PMID 31287989). Expression of dominant negative p53 (TP53DN), myrAkt1, RB1-shRNA, c-Myc, and Bcl2(PARCB forward transformation) using human naïve prostate basal epithelial cells recapitulated both transcriptional and histological characteristics of small cell neuroendocrine prostate cancer (NEPC) (Park et al., PMID 30287662). To study the temporal transcriptional landscape during this trans-differentiation process, we conducted a time course study using a PARCB model by integrating multi-omics sequencing, including bulk RNA-sequencing and ATAC-sequencing on samples taken at different time point, as well as single cell RNA sequencing on serial xenograft tumors. We found a common SCN pathway that resulted in two distinct end states defined by mutually exclusive expression of ASCL1 and ASCL2. Further investigation using CUT&RUN sequencing identified TFAP4 as a potential epigenetic regulator of both proteins. Our study reveals temporal and transcriptional changes from prostate adenocarcinoma to NEPC trans-differentiation.

  Study phs003230

• Distinct immune cell infiltration patterns in pancreatic ductal adenocarcinoma (PDAC) exhibit divergent immune cell selection and immunosuppressive mechanisms

  Pancreatic ductal adenocarcinoma has a dismal prognosis. A comprehensive analysis of single-cell multi-omic data from matched tumour-infiltrated CD45+ cells and peripheral blood in 12 patients, and two published datasets, reveals a complex immune infiltrate. Patients have either a myeloid-enriched or adaptive-enriched tumour microenvironment. Lymphocyte enrichment is intrinsically linked with highly distinct B and T cell clonal selection, diversification, and differentiation. Using TCR data, we see the largest clonal expansions in CD8 effector memory, senescent cells, and highly activated regulatory T cells which are induced within the tumour from naïve cells. We identify pathways that potentially lead to a suppressive microenvironement, including targets of immunotherapy and checkpoints including TIGIT/PVR and SIRPA/CD47. PDAC patient tumors from the APACT clinical trial revealed that patients with myeloid enrichment had the shorter overall survival compared to those adaptive cell enrichment. We identify multiple therapeutic targets that should form the basis for rational design including boosting of B cell responses, targeting immunosuppressive macrophages, and specific Treg depletion approaches. The dataset is scRNA-seq data from PDAC patients.

  Dac EGAC50000000319

• Programs, Origins, and Immunomodulatory Functions of Myeloid Cells in Gliomas

  Gliomas are challenging malignancies characterized by an immunosuppressive microenvironment filled with myeloid cells, whose roles in immune modulation are not fully understood. In this study, we utilized single-cell RNA sequencing (scRNA-seq) data from 85 primary human glioma tumors, related blood samples, and brain tumor organoid models. We found that nearly all glioma-associated myeloid cells express at least one of four distinct immunomodulatory activity programs. These programs include:1. Scavenger Immunosuppressive Program2. Complement Immunosuppressive Program3. Microglial Inflammatory Program4. Systemic Inflammatory ProgramAll four programs are found in both lower-grade and high-grade gliomas and are expressed across various myeloid cell types, whether derived from blood or resident origins. We validated the remarkable plasticity of myeloid cells by showing that the introduction of peripheral blood monocytes into glioma organoid models can induce the emergence of identities resembling microglia, macrophages, and dendritic cells, as well as all four immunomodulatory programs. Our study provides a valuable resource and a new framework for understanding the role of immunomodulatory myeloid cells in gliomas, laying the groundwork for developing effective immunotherapy strategies for glioma patients.

  Study phs003756

• Loss of SDHB promotes dysregulated iron homeostasis, oxidative stress and sensitivity to ascorbate

  Succinate dehydrogenase is a key enzyme in the tricarboxylic acid cycle and the electron transport chain. All four subunits of succinate dehydrogenase are tumor suppressor genes predisposing to paraganglioma, but only mutations in the SDHB subunit are associated with increased risk of metastasis. Here we generated an Sdhd knockout chromaffin cell line and compared it to Sdhb-deficient cells. Both cell types exhibited similar SDH loss of function, metabolic adaptation, and succinate accumulation. In contrast, Sdhb-/- cells showed hallmarks of mesenchymal transition associated with increased DNA hypermethylation and a stronger pseudo-hypoxic phenotype compared to Sdhd-/- cells. Loss of SDHB specifically led to increased oxidative stress associated with dysregulated iron and copper homeostasis in the absence of NRF2 activation. High-dose ascorbate exacerbated the increase in mitochondrial reactive oxygen species, leading to cell death in Sdhb-/- cells. These data establish a mechanism linking oxidative stress to iron homeostasis that specifically occurs in SDHB deficient cells and may promote metastasis. They also highlight high-dose ascorbate as a promising therapeutic strategy for SDHB-related cancers.

  Study EGAS00001005279

• Sarcoma long-read nanopore whole-genome sequencing Data Access Committee

  Sarcoma long-read nanopore whole-genome sequencing Data Access Committee.

  Dac EGAC50000000415

• Mayo Clinic - Fecal Microbiota and Adenomas

  Background: Adenomatous polyps are the most common precursor to colorectal cancer (CRC), the second leading cause of cancer death in the United States. We sought to learn more about early events of carcinogenesis by investigating shifts in the gut microbiota of patients with adenomas. Methods: We analyzed 16S rRNA gene sequences from the fecal microbiota of patients with adenomas (n=233) and without (n=547). Results: Multiple taxa were significantly more abundant in patients with adenomas, including Bilophila, Desulfovibrio, pro-inflammatory bacteria in the genus Mogibacterium, and multiple Bacteroidetes species. Patients without adenomas had greater abundances of Veillonella, Firmicutes (Order Clostridia), and Actinobacteria (family Bifidobacteriales). Many of our findings were consistent with previously reported shifts in the gut microbiota of CRC patients. Importantly, the altered adenoma profile is predicted to increase primary and secondary bile acid production, as well as starch, sucrose, lipid, and phenylpropanoid metabolism. Conclusions: These data suggest that diets rich in refined sugar, protein, and lipids may lead to increased bile acid production, creating a colonic environment that promotes the growth of bile-tolerant microbes such as Bilophilia and Desulfovibrio. In turn, these microbes may produce genotoxic or inflammatory metabolites such as H2S and secondary bile acids, catalyzing adenoma development and eventually CRC. Impact: This study suggests a plausible biological mechanism to explain the links between diet, shifts in the microbiota, and CRC. This represents a first step toward resolving the complex interactions that shape the adenoma-carcinoma sequence of CRC and may facilitate personalized therapeutics focused on the microbiota.

  Study phs001204

• Somatic Mutations in Individual Skin Cells

  Ultraviolet (UV) radiation is the primary cause of melanoma through the acquisition of driver mutations in melanocytes. It also plays a significant role in oncogenesis in other skin cells, such as keratinocytes. However, the mutational profiles vary widely among different skin cancers, and the early mutational processes in different cell types from the same skin, is not well understood. Additionally, our preliminary studies also suggest that the mutation burden in different skin cells vary significantly based on risk factors such as the anatomical site and the use of tanning beds. To explore this, we employed innovative Next Generation Sequencing (NGS) tools to perform a site-matched comparison of the genomic landscapes of melanocytes, keratinocytes, and fibroblasts. From 20 biopsies of physiologically normal skin, collected from various anatomical sites across 16 donors, we have performed DNA-sequencing on 106 melanocytes, 78 keratinocytes and 13 fibroblasts. Of these samples, we have also simultaneously performed RNA-sequencing on 78 melanocytes, 46 keratinocytes and 9 fibroblasts. For normal bulk DNA, we also performed targeted (UCSF500; n=9) or exome sequencing (n=8) of skin or saliva samples from the donors.

  Study phs003683

• Czech Roma and non-Roma array data

  42 Roma and 52 non-Roma Czech volunteers genotyped with the Axiom TM genome-wide human origins array

  Dac EGAC50000000478

• Spatiotemporal Charting of Human Esophageal Development for Epidermolysis Bullosa Cell Therapy

  Human fetal esophageal development is not well understood. We present a spatio-temporal single-cell multi-omics atlas to close such a long-standing knowledge gap. With such an atlas, we describe the cellular heterogeneity and lineage transitions of esophageal epithelium and stroma. We delineate the cellular dynamics of both epithelial and stromal populations during the establishment of esophageal tissue architecture. We identify niche paracrine signals that drive the development of the epithelium. We develop an in silico perturbation deep learning algorithm to further enlighten the in vitro derivation of esophageal basal cells (eBCs) and we use the algorithm to screen for effective and efficient signaling pathway perturbations that could guide in vitro eBC differentiation. We observe that chemically perturbing prioritized pathways yields functional eBCs. Such success sheds light on cell replacement therapy of eBC dysfunction, such as Epidermolysis Bullosa.

  Study phs003281

• Genotyping Data From Subjects With Brain Lesions

  These data are from subjects with adult diffuse glioma (IDH wildtype, IDH mutant/1p19q intact, and IDH mutant/1p19q co-deleted), brain lesions, tumefactive multiple sclerosis, brain metastases, central nervous system lymphoma and controls genotyped on the Affymetrix Axiom Precision Medicine array. Data from this study were used for case/control association studies and developing polygenic risk scores.

  Study phs003806

• Evolutionary Pressures Shape Undifferentiated Pleomorphic Sarcoma Development and Radiotherapy Response

  To study tumor evolution during tumorigenesis and in response to radiotherapy, we performed whole exome sequencing of 120 spatially distinct tumor regions and matched germline DNA from 20 patients with undifferentiated pleomorphic sarcoma. This data was utilized to generate personalized capture probes for targeted resequencing of the tumor and normal samples along with 17 matched plasma samples for circulating tumor DNA analysis. We found evidence of subclonal selection prior to treatment that was increased after radiotherapy. In addition, circulating tumor DNA analysis was able to measure the abundance of subclones before, during, and after treatment. This dbGaP submission includes whole exome sequencing and targeted resequencing from the study.

  Study phs003830

• A Platform Study of Combination Immunotherapy for the Neoadjuvant and Adjuvant Treatment of Patients with Surgically Resectable Adenocarcinoma of the Pancreas

  This is a single-institutional, randomized, open label platform clinical trial testing various immunotherapy combinations. Patients with newly diagnosed and surgically resectable pancreatic ductal adenocarcinoma (PDA) and scheduled to undergo the Whipple procedure at Johns Hopkins Hospital were eligible to participate in this study. Criteria for determining resectability strictly followed National Comprehensive Cancer Network (NCCN) guidelines. The study consisted of 6 parts: parts 1-5 constituted the Prime Phase (see below), and part 6 was the Extended Treatment Phase. Part 1: Participants received one cycle of immunotherapy two weeks prior to undergoing the Whipple procedure. Part 2: Subjects underwent the Whipple procedure. Part 3: Subjects received a second cycle of immunotherapy 4-10 weeks following the Whipple procedure (2-4 weeks prior to adjuvant chemoradiation). Part 4: Subjects underwent chemoradiation. Part 5: Subjects received 4 additional 28-day cycles of immunotherapy beginning 1-2 months after completing chemoradiation for a total of six cycles (two before chemoradiation and 4 following chemoradiation). Eligible subjects were randomized to Arms A and B in a 1:1 ratio, stratified up-front by age (≤65, >65). Arm A participants received Cy/GVAX. Arm B participants received the combination of Cy/GVAX and nivolumab. GVAX Vaccine consists of equal numbers (2.5 x 108 each) of Panc 6.03 pcDNA1GM-CSF and Panc 10.05 pcDNA1GM-CSF combined into a single vaccination. Each vaccination consisted of six total intradermal injections. A single intravenous (IV) dose of 200 mg/m2 Cy (CytoxanR) was given one day prior to GVAX. Anti-PD-1 Therapeutic Antibody Nivolumab 480 mg every 4 weeks was administered as an intravenous infusion. The primary objective for Arms A and B was to compare IL17 expression (Th17) in vaccine-induced lymphoid aggregates between resected PDAs from patients treated with the combination of Cy/GVAX and anti-PD-1 blockade antibody vs. the treatment of Cy/GVAX alone. Secondary objectives were to assess the safety, overall survival (OS), and disease free survival (DFS) of patients treated with each of the study drug combinations, and to assess the effects of each of the immunotherapy study drug combinations on PD-L1/PD-1 associated pathways, vaccine-induced immune regulatory signatures, and peripheral and intratumoral antigen specific T cell responses. The exploratory objective was to explore the effects of therapy on tumor and peripheral blood and tumor infiltrating immune cells, and to explore potential molecular determinants of response, progression and disease stability. To these ends, tumor infiltrating immune cells (TIICs) were obtained from surgically resected tumors following the neoadjuvant treatment of the study immunotherapy. TIICs were sorted into CD3+CD4+ T cells, CD3+CD8+ T cells, CD3-CD19+ B cells, and CD3-CD19-CD11b+ myeloid cells by flow cytometry. The sorted immune cell subtype pellets were sent to the commercial vendor (Eurofins) for RNA extraction and sequencing. SMART-seq v4 Ultra Low Input mRNA Sample Prep Kit was used for library preparation with 100bp paired end reads. FASTQ files, that were returned from the vendor, are deposited here.

  Study phs003002

• Yale SPORE in Skin Cancer Project 2

  Understanding the relationship between tumor and peripheral immune environments could allow longitudinal immune monitoring in cancer. Here, we examined whether T cells that share the same TCRab and are found in both tumor and blood can be interrogated to gain insight into the ongoing tumor T cell response. Paired transcriptome and TCRab repertoire of circulating and tumor-infiltrating T cells were analyzed at the single cell level from matched tumor and blood from patients with metastatic melanoma. The data shared here consist of gene expression matrix and fastq files obtained from sequencing single-cell libraries generated with the Chromium (TM) 5' technique. For each of 18 immunotherapy naive and 11 previously treated melanoma patients, T cells (Live/CD45+/TcRab+) were FACS-sorted from PBMCs and freshly resected tumors. Metadata associated with each individual cell consist of Patient I.D., biological sex, immunotherapy status, amino acid and nucleotide CDR3 sequence of the TCR alpha and beta chain (obtained from matched VDJ region enriched libraries), and sequencing batch. Further details about previous treatment history and other clinical parameters can be found in the associated manuscripts (Lucca et al., 2021: PMID: 33651881; Lu et al., PMID: 39609626).

  Study phs002289

• MDACC GBM Data Access Committee

  Retrospective global-omics analyses of an anti-PD-L1 treated cohort of newly diagnosed glioblastoma.

  Dac EGAC50000000477

• Melanoma Genome Sequencing Project

  Melanoma is the most prevalent cause of skin cancer morbidity and mortality. In order to characterize the full range of somatic mutations that may drive the growth of melanoma, we are sequencing tumor and normal DNA from a set of roughly 150 melanomas. For the majority of samples (approximately 90% of the cases), mutations in protein coding genes will be assessed in the exonic DNA of tumor-normal pairs using hybrid capture and paired-end DNA sequencing. For a few of DNA samples (approximately 10% of the cases), the entire genomes will be analyzed to assess the possible contribution of complex structural rearrangements contributing to oncogenesis. The sequencing data are supplemented by copy number profiling on the same tumors using high-density SNP arrays. Integration of these approaches will enable the unbiased and comprehensive characterization of both known and novel recurrent DNA alterations that arise in melanoma.Versions 1-4 contain whole exome and bulk RNA sequencing data for patients with melanoma.Version 5 - We compared somatic genomic profiles from matched pre-treatment and post-resistance tumor biopsies in patients with metastatic melanoma who exhibited heterogeneous responses to immune checkpoint inhibitors (ICIs). This version includes whole exome sequencing (WES) data from 14 patients.

  Study phs000452

• Identification of Novel Immunotherapy Targets in Myeloma

  RNA sequencing (RNA-Seq) was performed on 94 multiple myeloma (MM) patient samples. We used genomic subgroup and high-risk markers to identify therapeutic targets, including TNFRSF17, GPRC5D, ITGA4, and LAX1, with low predicted toxicity and high specificity to MM and genomic subgroups such as those with TP53 alterations.

  Study phs003772

• MDACC Lymphoma & Myeloma WGS of Tumor and Non-tumor Cells in Multiple Myeloma

  FastQ files from paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dac EGAC50000000282

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• International Cancer Proteogenome Consortium (ICPC): Proteogenomics of Oral Squamous Cell Carcinoma in Taiwan

  Oral cavity squamous cell carcinoma (OSCC) is the major subtype (~90%) of oral cancer, which is leading cancer with high mortality worldwide. The environmental risk factors associated with OSCC are quite different in Taiwan as compared to other populations. In most non-Taiwanese populations, OSCC is often associated with tobacco chewing, cigarette smoking, alcohol drinking, or human papillomavirus (HPV) infection. In Taiwan, in contrast, the OSCC occurs mainly in males aged 30 years or older who have habitual betel nut chewing, cigarette smoking, and alcohol drinking. To uncover molecular mechanisms and identify new therapeutic strategies of oral squamous cell carcinoma, this study recruited 112 treatment-naïve OSCC patients and generated multi-omics data, including WES, RNA-Seq, TMT-labeled proteomes, and phosphoproteomes from paired normal/tumor tissues. We have investigated our multi-omics data, covering molecular characterizations such as mutation signatures, impacts of mutations on RNA/protein/phosphoprotein, RNA-protein correlation, somatic copy number alteration, and the relationship with RNA & protein, proteome, and phosphoproteome analysis (T vs NAT), novel peptides (somatic variants, neoantigens, CT antigens, T cell receptors, etc.), as well as molecular subtyping (& pathway analysis). Notably, we have discovered a higher frequency of APOBEC3B deletion polymorphism in the Taiwanese population, and APOBEC3A is a potential prognostic biomarker. Our proteogenomic data enable us to further stratify patients into four groups based on APOBE3A expression level, which is found inversely correlated with EGFR expression. Therefore, the patients with high EGFR and low APOBEC3A expression may benefit from anti-EGFR therapy, while those with low EGFR and high APOBEC3A expression may benefit from immunotherapy. To clarify if there is an interaction between genetic polymorphisms and betel nut chewing habit in Taiwanese OSCC, we plan to concurrently evaluate the effect of habitual betel nut chewing on the gene mutation pattern, the dysregulated protein/phosphoproteins as novel biomarkers and/or therapeutic targets, and the molecular subtyping of patients for effective treatments. 

  Study phs002580

• Childhood Cancer Data Initiative (CCDI): Pediatric In Vivo Testing Program - Neuroblastoma

  The goal of NCI's Pediatric In Vivo Testing Consortium (PIVOT) is to advance the development of effective treatments for pediatric cancers through preclinical in vivo testing of novel therapeutic agents. To design impactful experiments that can be rapidly translated to the clinic, PIVOT investigators require comprehensive genomic characterization of the patient-derived xenograft (PDX) models used across the consortium. This robust experimental design enhances collaboration with industry partners by providing proof-of-concept data for drugs in development. As part of this effort, neuroblastoma PDX models are being molecularly characterized to identify promising therapeutic candidates. The molecular profiling includes whole exome sequencing (WES), RNA-seq, MethylEPIC array, CytoSNP array, and DNA fingerprinting for quality control. Additionally, demographic and clinical data (e.g., diagnosis, disease site, disease status) are shared. These characterized PDX models, matched with patient tumors, guide model selection for preclinical drug testing.

  Study phs003163

• TIGER-LC High-Throughput Sequencing

  Intrahepatic cholangiocarcinoma (CCA) and hepatocellular carcinoma (HCC) are clinically disparate primary liver cancers with etiological and biological heterogeneity. We performed sequencing on multiple data levels of Thai CCA and HCC among the Thailand Initiative in Genomics and Expression Research for Liver Cancer (TIGER-LC) cohort using targeted OncoVar platform, whole exome, whole transcriptome, and whole genome metagenomic sequencing.

  Study phs001199

• A Clone's Genomic Stability as a Biomarker of Its DNA-Damage Resilience

  A main problem in the treatment of advanced cancers, including gastric cancers and glioblastoma, is the incertitude at which we predict how individual patients will respond to DNA-damaging agents, especially on the long run. Knowing the mechanism behind a patient's response, or the lack thereof, will help us depart from the oversimplified “more-is-better” and “one-size-fits-all” principles according to which DNA-damaging agents are administered. This will improve clinical outcome by allowing us to pinpoint those who would respond better and longer to lower doses than to higher doses of DNA-damaging agents. Under the assumption that the success of DNA-damaging therapy increases with the proliferation rate of a relatively homogeneous tumor population, there was little reason to assume anything other than monotonic dose-response relations. With the recent paradigm shift that most cancers are in fact DNA mosaic products of ongoing evolution, comes the urgency to reconsider these fundamental principles behind DNA-damaging therapy administration. As the developers of one of the first DNA deconvolution methods and with access to technologies to profile the transcriptomes of up to 10,000 cells simultaneously, we are equipped to embark on first personalized dose-finding strategies for DNA-damaging therapies. We will test the potential of the very long-term legacy that DNA-damage entails on a cell “genomic instability” as new biomarker of DNA-damage response. Our preliminary studies showed that, for most cancer types, DNA-damaging agents change a clone's genomic instability and that clones succumb to a limit in the amount of genomic instability they can tolerate. In particular, our results showed that patients with intermediate genomic instability have a very poor outcome and that this relation is only evident among treatment-naive patients, but not among patients treated with DNA-damaging agents. Further they show that we can measure genomic instability per clone and that clones with extreme genomic instability typically don't grow large. Our hypothesis that genomic instability, rather than proliferation rate, determines how sensitive a tumor is to DNA-damaging agents on the long-term, is founded on two unexpected findings. Patients with extremely high genomic instability per tumor clone have an exceptionally good outcome. Aim 1 will integrate exome- and single cell RNA-Seq (scRNA-Seq) data to characterize clones and to measure how much genomic instability they can tolerate. Low genomic instability is associated with reduced benefit from DNA-damaging agents. Aim 2 will use comet assays and treatment history to quantify DNA damage per clone, relating it to the clones' ability to tolerate DNA damage and to changes in the genomic instability of therapy-surviving clones.

  Study phs003762

• Assessing Individual Head and Neck Squamous Cell Carcinoma Patient Response to Therapy Through Integration of Functional and Genomic Data

  This study combines RNA sequencing (RNASeq), whole exome sequencing (WES), reverse phase protein array (RPPA) and copy number variation (CNV) data, along with a custom high throughput inhibitor assay to characterize tumor cells from patients with head and neck squamous cell carcinoma (HNSCC), in order to identify potential therapy targets on an individual patient basis. The data that will be available through dbGaP include the RNASeq, WES, RPPA and array CNV data for the tumor and matched normal samples. This study represents a proof-of-concept. No treatments were administered to patients as part of this study.

  Study phs003456

• Metabolic Biomarkers in Thoracic Cancers

  Here we present RNA sequencing (RNA-Seq) of non-small cell lung cancer (NSCLC) and adjacent lung tissue. These samples were acquired from primarily untreated, surgically resected primary tumors. The first analysis published with this data was to determine the metabolic signatures between primary tumors and adjacent lung tissue.The associated clinical trial (NCT02095808) includes patients with many kinds of thoracic cancers, including NSCLC and other diseases, such as thymoma and esophageal adenocarcinoma. However, the current dbGaP data is focused on the NSCLCs described in the associated paper.

  Study phs003880

• A Personalized Neoantigen Vaccine Generates Anti-Tumor Immunity in High-Risk Renal Cell Carcinoma

  Personalized cancer vaccines (PCVs) can generate circulating immune responses against predicted neoantigens. However, whether such responses can target cancer driver mutations, lead to immune recognition of a patient's tumor, and result in clinical activity are largely unknown, particularly in patients with lower mutation burden tumors. We conducted a phase I trial testing a neoantigen-targeting PCV in patients with high-risk, fully resected clear cell renal cell carcinoma (RCC; stage III or IV), with or without ipilimumab administered adjacent to the vaccine. At a median follow-up of 40.2 months from surgery, none of the 9 initial participants experienced a recurrence of RCC. No dose-limiting toxicities were observed. All patients generated T cell immune responses against PCV antigens, including RCC driver mutations in VHL, PBRM1, BAP1, KDM5C, and PIK3CA. Following vaccination, there was a durable expansion of peripheral T cell clones, and T cell reactivity against autologous tumor was detected in 7 of the 9 patients. Our results demonstrate that neoantigen-targeting PCVs in high-risk RCC are highly immunogenic, capable of targeting key driver mutations, and induce anti-tumor immunity. These observations, in conjunction with the absence of recurrence in all 9 vaccinated patients, highlights the promise of PCV as effective adjuvant therapy in RCC. We are submitting WES data from whole blood samples and tumor FFPE samples, and RNA-Seq data from tumor FFPE samples. We are also submitting RNA-Seq data from purified tumor samples. scRNA-seq data will be submitted for skin samples (vaccine site biopsies at Weeks 0, 4, and 13), tumor samples (including resected metastatic tumor samples for two patients), and normal kidney samples. Bulk TCR-seq data will be submitted for blood samples.

  Study phs003710

• CD4 T Cell Subsets in Human Metastatic Melanoma

  We used single-cell RNA-sequencing (scRNA-seq) to define CD4+ T-cell subsets in melanoma tumors from patients undergoing tumor resection. All patients received immune checkpoint blockade prior to surgery. We identified multiple subsets in the tumor with transcriptional features of suppressive function, including TR1 cells and FOXP3+ Treg cells. Based on transcriptional profiles, classical helper T cell subsets were not prevalent.

  Study phs003816

• Spatial Transcriptomics of Vaccine Therapy With or Without Cyclophosphamide in Treating Patients Undergoing Chemotherapy and Radiation Therapy for Stage I or Stage II Pancreatic Cancer That Can Be Removed by Surgery

  Pancreatic ductal adenocarcinoma (PDAC) is a rapidly progressing cancer that responds poorly to immunotherapies. Intratumoral tertiary lymphoid structures (TLS) have been associated with rare long-term PDAC survivors, but the role of TLS in PDAC and their spatial relationships within the context of the broader tumor microenvironment remain unknown. Here, spatial transcriptomics data were generated from 16 pancreatic cancer patients treated with GVAX, whose tumors presented with induced intratumoral TLS. Resected tumor specimens were embedded in OCT media and freshly frozen. Sections were cut into 6.5 x 6.5 mm dimensions compatible with Visium spatial transcriptomics slides. TLS-positive tumor sections from 14 patients (14 tumor samples in total) and lymph nodes from remaining patients (2 lymph node samples in total) were selected by an expert pathologist for profiling. We used 4 Visium slides and covered the 16 capture areas with sections cut in a cryostat at 10 µm. The fresh frozen Visium protocol was followed according to manufacturer's recommendations (10x Genomics Spatial 3' v1). Tissue permeabilization and library construction was carried out according to the manufacturer's protocols. Permeabilization time was optimized to 30 minutes. The captured tissue sections were permeabilized to allow RNA to be captured onto the slide where it reverse-transcribed to cDNA. The cDNA was then amplified, and sequencing libraries were prepared using the 10x Genomics Visium Spatial Gene Expression Reagent Kit for Library Preparation. The libraries were then sequenced using an Illumina NovaSeq sequencer. The raw data obtained from the sequencing were processed using the SpaceRanger (spaceranger-1.2.0) pipeline for alignment onto the GRCh38-2020-A reference transcriptome quantification of gene expression. Unsupervised learning generated a TLS-specific spatial gene expression signature that significantly associates with improved survival in PDAC patients. These analyses demonstrate TLS-associated intratumoral B cell maturation.

  Study phs003862

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• Genomics Analysis Reveals Molecular Patterns of Tumorigenesis in HPV-Associated and HPV-Independent Sinonasal Squamous Cell Carcinoma

  The goal of this study was to identify molecular mechanisms of tumorigenesis in HPV-associated and HPV-independent sinonasal carcinoma using high-throughput sequencing approaches. Whole genome sequencing was performed for HPV-associated samples and whole exome sequencing for HPV-independent samples. Ultimately, we identified distinct molecular patterns of tumorigenesis between HPV-associated and HPV-independent disease. Data from patients for which informed consent allowed public sharing are included here.

  Study phs003591

• A Phase I Study of the Treatment of Recurrent Malignant Glioma with CAN-3110 (AKA rQNestin34.5v.2), a Genetically Engineered HSV-1 Virus

  This study is a "first-in-human" phase 1 trial of recurrent, IDH wild-type glioblastoma (rGBM) patients treated with CAN-3110 (aka rQNestin34.5v.2), a genetically modified oncolytic herpes simplex virus 1 (HSV-1). The study was a 3+3 dose-escalation study starting at a single intra-tumoral injection of 106 PFU CAN-3110 going up to 1010 PFU in half-log increments (cohorts 1-9). An expansion cohort (cohort 10) was treated with 109 PFU injected into up to 5 sites within a single tumor. Principal findings of the study conclude that:CAN-3110 was safe at all tested doses (no dose-limiting toxicities reached)HSV-1 seropositive patients survived significantly longer than HSV-1 seronegative patients in this study - longer than expected based on historical rGBM controlsHSV-1 seropositive patients were significantly more likely to clear CAN-3110 (HSV-1) antigen from their tumors based on immunohistochemical stainingCAN-3110 treatment-induced CD8+/CD4+ T-cell recruitment to injected tumor sites altered TCR beta diversity in both tumor infiltrating leukocytes (TILs) and PBMCs, and initiated changes in specific TCR beta clonotypes and immune gene signatures which were associated with post-treatment survival.Data provided in dbGaP for this study include:Bulk RNA-Seq data for 13 pre/post-treatment pairs of rGBM tumors corresponding to 12 unique patients (patient 28 was treated with CAN-3110 at two different timepoints). This data is provided as raw sequencing reads (.fastq), kallisto pseudoalignment transcript-level read counts (abundance.tsv files), gene-level abundance matrix (Gene_Level_Expression_Matrix.tsv), and immune gene signature scores matrix (Immune_Gene_Signatures_Matrix.tsv). Sequencing was performed as paired 150bp sequencing on NovaSeq6000 S4 Illumina flow cells. Library preparation varied by batch as described in the included RNAseq_Metadata.xlsx table.TCR beta DNA sequencing performed by Adaptive Biotechnologies for 21 pre/post-treatment pairs of rGBM tumors and PBMCs representing 20 unique patients (patient 28 was treated with CAN-3110 at two different timepoints). Note that all tumor pairs with TCR beta sequencing data also have available bulk RNA-Seq data. The TCR beta sequencing data is provided as an excel spreadsheet (TCRbeta_Sample_Overview.xslx), which provides a broad level summary of the sequencing on a per-sample basis (# of TCRbeta templates, T cell fraction, TCR beta diversity metrics, etc.) and as a large tab separated value file (Full_TCRbeta_Rearrangement_Details.tsv), which provides information per sample at the level of each unique TCR beta sequence (amino/nucleic acid sequence, VDJ gene usage, etc.).An excel table of de-identified metadata for the patients involved in this study.

  Study phs003378

• Integrated Somatic and Germline Molecular Properties Dictating Biological and Clinical Phenotypes in Cancer

  We performed single-nuclei matched RNA- and ATAC-sequencing of frozen biopsies from normal adjacent tissue, primary and metastatic esophageal adenocarcinoma specimens. The data was then further stratified into a tumor microenvironment and malignant compartment and was computationally analyzed to reveal cancer cell subtypes and programs driving malignancy.

  Study phs003438

• Addiction of Primary Cutaneous Gamma-Delta T-cell Lymphomas to JAK-STAT Signaling

  Primary cutaneous γδ T-cell lymphoma (PCGDTL) is a mature T-cell lymphoma (TCL) of the skin with a median survival of 31 months and no effective therapies. PCGDTLs frequently possess mutations in the JAK/STAT pathway, including in JAK1, JAK3, STAT3, STAT5B, and SOCS1. We hypothesized that single-agent JAK inhibition may be effective in PCGDTLs, particularly those with targetable JAK/STAT pathway mutations. Herein, we demonstrate the near-complete response of two PCGDTL cases to single-agent JAK inhibitors, ruxolitinib or cerdulatinib. However, both patients eventually relapsed with acquired mutations in JAK1, JAK3, or STAT5B.

  Study phs003837

• Immune-Related Adverse Events after Immune Checkpoint Blockade-Based Therapy are Associated with Improved Survival in Advanced Sarcoma

  Immune activation after immune checkpoint blockade (ICB) can lead to a unique group of adverse events (AEs), which have been associated with improved outcome in many carcinomas. The association between immune-related AEs (irAEs) and outcome in patients with sarcoma is not well studied. This study has two components: (1) a retrospective clinical study of irAEs among 131 patients treated with ICB at Memorial Sloan Kettering Cancer Center and (2) an analysis of a subset of these patients who have whole transcriptome sequencing available for analysis. In the clinical study portion, we reviewed a cohort of patients with advanced sarcoma treated on prospective clinical trials utilizing ICB-based therapy between April 2017 and January 2020. The objectives were to pool the safety data from each trial, identify irAEs, and correlate them with best overall response by RECIST 1.1, progression-free survival (PFS) and overall survival (OS). Association of irAEs with response and survival was assessed using a Cox regression model. A total of 131 patients were included. Forty-two (32%) had at least one irAE of any grade and 16 (12%) had at least one Grade ≥ 3 irAE. On Cox analysis adjusting for clinical covariates that were significant in the univariate setting, the hazard ratio (HR) for an irAE (HR 0.662, 95% CI 0.421 - 1.041) approached, but did not reach statistical significance for PFS (P = 0.074), while patients had a significantly lower HR for OS (HR 0.443, 95% CI 0.246 – 0.798; P = 0.007) compared to those without or before an irAE. Tumor samples with available RNA sequencing data were stratified by presence of an irAE to identify patterns of differential gene expression. In total, 71 unique patients had RNA sequencing available for analysis. The transcriptomes of 31 of these patients have been previously uploaded to dbGaP (phs002852), leaving 36 unique transcriptomes that have not been previously publicly shared. Three patients did not agree for their sequencing to be publicly shared. Therefore, 33 unique patient samples will be uploaded to this dbGaP study. Overall, this study found that gene expression profiling on baseline tumor samples from patients who had an irAE had higher numbers of tumor-infiltrating dendritic cells, CD8+ T cells, and regulatory T cells as well as upregulation of immune and inflammatory pathways.

  Study phs003284

• Multi-Omic Investigation of Beckwith-Wiedemann Syndrome Hepatoblastoma

  Hepatoblastoma (HB) is the most common malignant liver tumor diagnosed in children under 5 years of age. One of the most common HB predisposition syndromes is Beckwith-Wiedemann Syndrome (BWS, OMIM 130650), which affects approximately 1/10,000 live births. In this study, we perform Whole Exome Sequencing (WES), DNA methylation array, messenger RNA-Sequencing (mRNA-Seq), and microRNA-Sequencing (miRNA-Seq) to examine the genomic, methylomic, and transcriptomic signature of BWS HB. We analyzed five tumor-normal paired samples, two BWS tumor only samples, and five non-BWS control samples to identify a predisposition and oncogenic signature of BWS HB development. To further understand the new impact of 11p15 changes, specifically in the liver, we performed single-nucleus RNA sequencing (snRNA-seq) and single-nucleus assay for transposase-accessible chromatin with sequencing (snATAC-seq) to generate paired, cell-type-specific transcriptional and chromatin accessibility profiles of both BWS-liver and nonBWS-liver nontumorous and tumor tissues.

  Study phs002614

• DAC_RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Data access committee for RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Dac EGAC50000000352

• "IL-17A-Producing ILC3s and Duodenal Adenoma in FAP"

  Dac EGAC00001003301

• Immune Determinants of Resistance to PD-1 Blockade in Renal Cell Carcinoma

  We performed an integrated bulk and single-cell transcriptomic analysis of tumors from 102 advanced renal cell carcinoma patients enrolled in a phase II clinical trial of frontline nivolumab (NCT03117309) to investigate determinants of response to anti-PD1 monotherapy. The present study includes 112 archival or pre-treatment tumors of clear cell and non-clear cell histologies from 90 patients that underwent bulk RNA sequencing (RNA-seq). For 76 patients, 74 of whom had matched RNA-seq, whole exome sequencing (WES) was also performed on tumor samples as well as matched peripheral blood. Additionally, 19 fresh tumor samples from 17 patients, including pre and post-treatment samples and mixed histologies, were locally cryopreserved and centrally processed for single cell RNA (scRNA-seq) and TCR (scTCR-seq) sequencing. 7 patients had matched scRNA/scTCRseq, RNAseq, and WES.

  Study phs003618

• Aberrant RNA-splicing (neojunctions) offers a new source for targets, and our neoantigen discovery platform (SNIPP) characterizes a novel class of clonally-expressed splicing-derived neoantigens that elicit a CD8+ T-cell-mediated tumor killing response.

  RESULTS: Our pipeline identified 789 public neojunctions, with 32 neojunctions concurrently identified in transcriptomic and proteomic glioma data and predicted to be presented by HLA-A*02:01 with high confidence. IVS and subsequent 10x VDJ scRNA-seq identified TCR clonotypes reactive against neojunctions in RPL22 (n=7) and GNAS (n=1), the latter being highly intratumorally-conserved (detected in > 90% of spatially-mapped biopsies across 17/56 patients (26.78%)). TCR-transduced T-cells demonstrated recognition and immunogenic activation against endogenously processed and presented neoantigens in multiple GBM PDX cell lines. Furthermore, IDH1-mutant oligodendroglioma samples demonstrated significantly elevated expression of neojunctions over IDH1-mutant astrocytoma and IDH1wt subtypes. Differential gene expression (DESeq2) identified decreased expression of splicing factors due to oligodendroglioma-specific co-deletion of Chromosomes 1p/19q. siRNA knockdown of these splicing factors (e.g. SF3A3, SNRPD2) in IDH1wt glioma cells resulted in significantly increased expression of corresponding neojunctions.

  Study EGAS00001007986

• DNA Methylation in Prostate Tumor and Paired Benign Tissue for African and European Ancestry Men

  We recruited prostate cancer (PCa) patients undergoing robotic-assisted laparoscopic radical prostatectomy at the University of Chicago Medical Center Urology Clinic between 2011 and 2017. Our study includes 76 African American (AA) and 75 European American (EA) men with PCa of Gleason Score (GS) ≥7, recruited by the Epidemiology Research Recruitment Core at the University of Chicago. All patients consented to the collection of questionnaire data, prostate tissue, and medical records. The study was approved by the Institutional Review Board of the University of Chicago. Following prostatectomy, prostate tissue was sent to the Human Tissue Research Center (HTRC) at the University of Chicago. Each sample underwent histological examination and Gleason scoring by University of Chicago genitourinary pathologists. The presence of adenocarcinoma was confirmed by overexpression of alpha-methylacyl-coenzyme-A racemase (AMACR) and areas for DNA extraction were marked. Tissue samples used for DNA extraction were obtained using with either a 1mm biopunch or laser microdissection of a 100 µm2 area of tissue. Genome-wide DNA methylation profiles were generated using Illumina's Infinium MethylationEPIC BeadChip array kit. Genome-wide SNP data was generated (from benign tissue DNA) using the Illumina Infinium Multi-Ethnic Global-8 v1.0 array at the University of Chicago Genomics Core Facility. We performed imputation using the Haplotype Reference Consortium (HRC, Version r1.1 2016) panel, which includes all samples from the 1,000 Genomes Project (Phase 3), using the Michigan Imputation Server. The imputed SNP data for mQTL analysis was imputed based on genotype SNP data which was all from benign tissue DNA and the methylation data was identified in both tumor and benign tissue, both AA and EA men, and identified QTLs co-occuring with prostate cancer susceptibility loci.Data including SNP genotypes, DNA methylation, tissue type, and participant characteristics will be available in dbGaP.

  Study phs003516

• Depth of Response Correlates with Improved Outcomes for Early Interception in a High-Risk Smoldering Multiple Myeloma Clinical Trial Using the Combination of Ixazomib, Lenalidomide, and Dexamethasone

  Early treatment of patients with high-risk smoldering myeloma (HRSMM) has been shown to delay progression to multiple myeloma (MM), but not all patients respond well. Identifying biological predictors of response and resistance to treatment can help optimize treatment selection for patients and improve outcomes. Here, we investigate tumor and immune biomarkers of response to ixazomib, lenalidomide, and dexamethasone treatment (I-PRISM study) that can be measured at diagnosis. We performed single-cell RNA sequencing (scRNAseq), coupled with B cell receptor and T cell receptor sequencing, on CD138+ tumor and CD138- immune cells, respectively, from the bone marrow of 20 patients enrolled in the I-PRISM study.

  Study phs003827

• DAC for study involving the spatial transcriptomics analysis of HPV-dependent and HPV-independent vulval squamous cell carcinoma at Imperial College London.

  Dac EGAC00001003515

• ATAC-seq in KMS11 vs TKO cells

  ATAC-seq to determine chromatin accessibility in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of the translocated NSD2 allele.

  Study EGAS50000000076

• ChIP-seq in KMS11 and TKO cells

  Histone chIP-seq in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of translocated NSD2 allele (KMS11 TKO).

  Study EGAS50000000077

• MicroC in KMS11 and TKO cells

  MicroC to show high resolution chromatin interactions in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of translocated NSD2 allele (KMS11 TKO).

  Study EGAS50000000078

• Mutational Profile in Newly Diagnosed Diffuse Large B-Cell Lymphoma: Insights from the GAINED Study

  The GAINED study (NCT01659099) is a randomized phase 3 trial comparing obinutuzumab (G) to rituximab (R) in combination with ACVBP or CHOP14 induction, followed by PET-guided consolidation. This post-hoc analysis focuses on primary mediastinal B-cell lymphoma (PMBL) patients, confirmed through expert pathological review and characterized using gene-expression profiling (GEP) and Next-Generation Sequencing (NGS).

  Dac EGAC50000000540

• Mayo Clinic Adult Diffuse Glioma Illumina OncoArray SNP Data

  These data are from adult diffuse glioma subjects genotyped on the Illumina OncoArray. Data from this study were used for case control association studies and developing polygenic risk scores. Variants in D2HGDH and near FAM20C were identified that were associated with glioma subtypes (PMID: 32386320). Mutation and copy number data are included for select genes and chromosomes. IDH mutation and 1p/19q co-deletion are used in glioma diagnosis and are also prognostic markers. Data for additional prognostic genes and chromosomes are also included. RNA-seq and CHIP-seq data are available for select subjects from this cohort in GEO (GSE167806).

  Study phs003041

• Genomic Landscape of Multiple Myeloma and of its Precursor Conditions, and its Clinical Implications

  Reliable strategies to capture patients at risk of progression from precursor stages of multiple myeloma (MM) to overt disease are still missing. In this study, we generated whole-genome sequencing (WGS) data from matched tumor and normal samples from 98 individuals from the PCROWD study (Precursor Crowd, NCT02269592). These individuals have either a precursor condition for MM, which can be a monoclonal gammopathy of undetermined significance (MGUS) or smoldering multiple myeloma (SMM), or an active multiple myeloma (MM). To do so, we enriched tumor plasma cells from the bone marrow by magnetic bead selection (CD138+), sequenced the DNA of these samples to a target depth of 60X (tumor), and analyzed them against normal white blood cells (peripheral blood mononuclear cells) from the same individuals sequenced to a target depth of 30X (normal). In our first publication [Alberge, Dutta, Poletti, et al., 2025], we integrated and homogeneously analyzed these data together with data from mostly publicly available datasets (phs003084 and phs000748) to reach 1,030 total samples. We used these data to identify recurrent coding and non-coding candidate drivers, as well as significant hotspots of structural variation, and used those drivers to define and validate a simple “MM-like” score which we could use to place patients' tumors on a gradual axis of progression toward active disease. Our MM precursor genomic map provides new insights on the time of initiation and cell of origin of the disease, on the order of acquisition of genomic alterations, and on mutational processes found across stages of the transformation. Taken together, we highlight here the potential of genome sequencing to better inform risk assessment and monitoring of MM precursor conditions.

  Study phs003846

• Efficacy and Immune Effects of Anakinra Prophylaxis for Neurologic Toxicity and Cytokine Release Syndrome in Patients with Lymphoma Receiving Axicabtagene Ciloleucel

  Chimeric antigen receptor T cells have transformed the treatment of multiple hematologic malignancies, but are limited in application due to treatment-related toxicities. Cytokine release syndrome (CRS) and neurotoxicity (NT) are the primary toxicities associated with these therapies and are thought to be mediated by broad immune activation due to robust T-cell expansion. Current treatment of these toxicities utilize anti-IL-6 directed therapy and/or systemic glucocorticoids to mitigate the consequences of this complex inflammatory cascade. We sought to use anakinra, an IL-1R antagonist, as a prophylactic strategy to prevent clinically meaningful CRS/NT, defined as grade 2 or higher toxicity necessitating clinical intervention. Although our study, in line with others, demonstrated that IL-1R antagonism is insufficient to prevent such toxicities entirely, we were able to gain insight into the molecular immune signaling associated with breakthrough CRS & NT in the presence of anakinra prophylaxis using our scRNA dataset of patients treated with and without IL-1R antagonism. We demonstrate that IL-4 and IL-10 anti-inflammatory pathways in infused CAR-T products of both anakinra and non-anakinra cohorts were negatively associated with grade 2+ toxicities. We also found that expression of IFN-gamma pathways and ligand-receptor activities, as well as cytokine levels of IFN-gamma and CXCL10 in CD14+ monocytes, were significantly enriched in patients with breakthrough toxicity in the anakinra cohort. This correlated with an increase in IFN-gamma in the peripheral blood of patients with breakthrough toxicities, among other cytokines. These data identify IFN-gamma as a potential key mechanism in the development of CAR-T cell-associated toxcities and suggest that this pathway is also targetable and not inhibited by anakinra alone.

  Study phs003655

• Whole Exome Sequencing of Diffuse Large B-Cell Lymphoma

  We performed massively parallel whole exome sequencing of 55 primary tumor samples from patients with diffuse large B cell lymphoma (DLBCL) and matched normal tissue. We identified recurrent mutations in genes that are well known to be functionally relevant in DLBCL, as well as in genes for which a functional role in DLBCL has not been previously suspected. Significantly mutated genes include MYD88, CARD11, EZH2, CREBBP, as well as MEF2B, MLL2, BTG1, GNA13, ACTB, P2RY8, PCLO and TNFRSF14. Analysis of somatic mutations in patients with DLBCL also revealed that BCL2 mutations commonly occur in patients with BCL2/IgH rearrangements as a result of somatic hypermutation normally occurring at the IgH locus. The BCL2 point mutations are primarily synonymous, likely caused by activation-induced cytidine deaminase (AID)-mediated somatic hypermutation, and those non-synonymous mutations that are observed tend to be found outside of the functionally important BH domains of the protein, suggesting that strong negative selection against BCL2 loss-of-function mutations is at play. We further identified genes with mutations that are likely to be functionally relevant despite being mutated at a low rate. These genes include KRAS, BRAF and NOTCH1 as likely drivers of DLBCL pathogenesis in some patients.In order to facilitate additional in vitro and in vivo analyses of the discrete molecular clusters and associated targeted therapies in preclinical models, we also performed our subtyping analysis on 28 Diffuse Large B-Cell Lymphoma (DLBCL) cell lines. We performed whole exome sequencing (WES) on these cell lines to capture structural variants (SVs), from which we obtained full genetic characterization and segregation of these cell lines into our previously defined molecular clusters by DLBclass assignment. These analyses are available in an interactive DLBclass portal available to the public. Our data provide an unbiased view of the landscape of mutations in DLBCL. These data may point towards new targets for the treatment of DLBCL.

  Study phs000450

• IDH mutant Glioma methylation analysis and prognostic signatures

  Study EGAS00001006961

• Multiple Myeloma Clinical Targeted Sequencing of Patient Samples

  Purpose: Molecular diagnostics for the risk stratification of patients with multiple myeloma (MM) have languished in the area of cytogenetics and fluorescence in situ hybidization (FISH). However, here we present the case for next generation sequencing of MM patient samples to not only identify high-risk markers, but also mutations and deletions relating to immunomodulatory drugs (IMiDs), and more importantly to guide the sequencing of immunotherapy regimens in response to intrinsic antigen escape as a means of treatment resistance and relapse. Experimental design: CD138+ cell selected samples (n=134) from bone marrow aspirates from patients with multiple myeloma were sequenced using a targeted panel in a clinical diagnostics laboratory. Data were analyzed for high-risk markers, treatment-related resistance mechanisms, and precision medicine targets to guide the future treatment of patients in the clinic. Results: High-risk markers including t(4;14), t(14;16), t(14;20), gain or amplification 1q, deletion of CDKN2C, and deletion or mutation of TP53 were identified in 15% of newly diagnosed myeloma patient samples. At relapse, alterations in the cereblon degradation pathway were found in 24.3% of IMiD treated patients. Deletions of 4p (CD38) were also enriched in patients who received anti-CD38 treatment (P=0.03) which were mostly monoallelic. Deletions and mutations were detected in TNFRSF17 encoding BCMA in patients treated with anti-BCMA regimens, and the information was used to change the treatment of the patients. Conclusions: Targeted sequencing of multiple myeloma patient diagnostic samples can be used for risk stratification, and also to monitor and adjust treatments as resistance mechanisms evolve.

  Study phs003908

• MP2PRT-MNG: Identifying Novel Molecular Markers of Response to Radiotherapy in Meningiomas Using Samples from the RTOG-0539 (NCT00895622)

  The Molecular Profiling to Predict Response to Treatment (MP2PRT) program is part of the NCI's Cancer Moonshot Initiative. The aim of this program is the retrospective characterization and analysis of biospecimens collected from completed NCI-sponsored trials of the National Clinical Trials Network and the NCI Community Oncology Research Program. NRG RTOG (Radiation Therapy Oncology Group)-0539, which was a nonrandomized phase II cooperative group trial in 2009, was selected for inclusion in this program. NRG RTOG-0539 assigned patients with histologically confirmed diagnosis of meningioma to 1 of 3 risk groups based on 2007 WHO grade, resection extent, and recurrence status, and radiotherapy was given per protocol to the intermediate- and high-risk cases. Under the MP2PRT program, DNA methylation profiling, RNA sequencing, and whole exome sequencing were performed on clinical trial cases with available tissue for molecular analyte extraction and subsequent sequencing. Raw molecular data with metadata are available for this study.

  Study phs003707

• Targeting EGFR in NF1 Mutant Melanoma

  Our study focused on melanoma patients with driver mutations in the neurofibromin 1 (NF1) tumor suppressor gene, a subset of melanoma patients that have not benefitted from recent treatment advances. We have leveraged patient-derived short-term cultures (STCs) and multiomics approaches to identify molecular features that could be developed into therapies for NF1 mutant melanoma patients. Our studies revealed that the epidermal growth factor receptor (EGFR) is highly expressed and active in NF1 mutant melanoma cells, and that genetic or pharmacological EGFR inhibition impaired tumor cell proliferation, survival, and cell growth in patient-derived NF1 mutant but not NF1 wild-type melanoma models.

  Study phs003906

• Immediate Postoperative Minimal Residual Disease Detection with MAESTRO Predicts Recurrence and Survival in Head and Neck Cancer Patients Treated with Surgery

  We selected 24 patients with locally advanced head and neck squamous cell carcinoma (HNSCC) who were surgically treated. MAESTRO, our ultrasensitive, tumor-informed, mutation enrichment sequencing assay, was applied in a pooled format (MAESTRO-Pool) to plasma samples collected from these patients at baseline (pre-op) and postoperatively. We show that detection of circulating tumor DNA (ctDNA) 1 to 9 days after surgery is associated with significantly worse survival. Many plasma samples also had tumor fractions detected below 100 parts-per-million, the detection limit for first-generation commercial assays, highlighting the need for more sensitive ctDNA assays. Here we provide whole genome sequencing of matched tumor biopsy and normal germline DNA from 24 patients that were used to identify somatic single nucleotide variants (SNVs) to be tracked using our MAESTRO-Pool assay.

  Study phs003981

• SPECIAL (scATACseq): Dissecting the melanoma ecosystem one cell at the time during immunotherapy

  Characterising epigenome profiles of stage III/IV melanoma samples treated with ICB before and on treatment by single cell ATAC sequencing.

  Study EGAS50000001014

• Dac for "Development of a fully human glioblastoma-in-brain-spheroid model for accelerated translational research"

  This is the DAC for "Development of a fully human glioblastoma-in-brain-spheroid model for accelerated translational research" of Philipp Koch (philipp.koch@zi-mannheim.de), Frank Winkler (Frank.Winkler@med.uni-heidelberg.de), Moritz Mall( m.mall@dkfz-heidelberg.de)

  Dac EGAC50000000480

• Functional Variant rs9344 at 11q13.3 Regulates CCND1 Expression in Multiple Myeloma with t(11;14)

  Multiple myeloma (MM) is a plasma cell (PC) malignancy characterized by cytogenetic abnormalities, such as t(11;14)(q13;q32), resulting in CCND1 overexpression. The rs9344 G allele within CCND1 is the most significant susceptibility allele for t(11;14). We have found the G risk allele is enriched in both healthy individuals of African ancestry and African American individuals with MM. The overall aim of this study was to identify the mechanism behind why the G allele is enriched in t(11;14) MM. To reach this goal, we performed ATAC-seq from 100,000 CD138+ tumor cells from 26 patients with MM. In addition, we performed ChIP-seq using antibodies against H3K4me1, H3K27ac and H3K4me3 from 100,000 CD138+ tumor cells from 8 patients with MM. We used these data to evaluate whether the G allele of rs9344 is associated with elevated chromatin accessibility, H3K27ac and H3K4me3 in t(11;14) MM.

  Study phs003997

• Single-Cell Mitochondrial Mutation Lineage Tracing of Non-Dysplastic and Dysplastic Barrett's Esophagus

  This study addresses a critical knowledge gap in understanding Barrett's esophagus (BE), a common metaplastic condition and precursor to esophageal adenocarcinoma, by identifying lineage connections and cell states underlying its development and malignant transformation. We collected biopsies from 13 Barrett's esophagus patients undergoing routine surveillance endoscopy, sampling metaplastic tissue alongside normal squamous esophagus and gastric cardia tissues when clinically appropriate. Our novel approach integrated single-cell RNA sequencing of nearly 180,000 cells with mitochondrial DNA mutation analysis for lineage tracing, coupled with spatial transcriptomics and comprehensive whole-exome sequencing. For one patient with high-grade dysplasia, we performed detailed whole-exome sequencing analysis at 100x coverage on dissociated Barrett's esophagus cells alongside matched normal esophagus and gastric cardia tissues. This genomic profiling revealed critical genetic drivers of malignant transformation, including a truncating mutation in the mutation cluster region of APC (a negative WNT regulator), mutations in the tumor suppressor genes CDKN2A and TP53, and significant copy number alterations including loss of CDKN2A on chromosome 9. These genetic alterations corresponded with the transcriptional changes observed in our single-cell data, particularly WNT pathway dysregulation and the expansion of LGR5-expressing stem cells, providing molecular evidence for how single clones can initiate the dysplastic transformation. Data deposited in dbGaP consist specifically of the whole-exome sequencing raw files, processed variant calls, and copy number analyses from the single patient with high-grade dysplasia and matched normal esophagus and stomach control tissue. Whole exome sequencing was performed on an Illumina NovaSeq 6000. Sequencing data was preprocessed following the Genome Analysis Toolkit's (GATK) Best Practices. Sequencing data was analyzed with Mutect2 (GATK, v4.2.5.0) to identify short somatic mutations including single-nucleotide polymorphisms and insertions and deletions. The Barrett's esophagus sample was run with the two matched normals, as well as the publicly available germline resource somatic-hg38_af-only-gnomad.hg38.vcf.gz (GATK). Somatic variant calls were filtered using FilterMutectCalls (GATK) and loaded into the Integrative Genomics Viewer (v2.12.3) for identification of high-quality variants in known esophageal adenocarcinoma regulators. Copy number alterations in the Barrett's esophagus sample were estimated using CNVkit (v0.9.9). CNV, Mutect2, and SVC analyses will be made available through dbGAP. Copy number alterations in the Barrett's esophagus sample were estimated using CNVkit (v0.9.9) with the default run settings; a pooled reference was generated from the normal esophagus and stomach samples. Copy number results were plotted directly within CNVkit using the function scatter.

  Study phs003949

• P4HA1 Mediates Hypoxia-Induced Invasion in Human Pancreatic Cancer Organoids

  Pancreatic ductal adenocarcinoma (PDAC) is an aggressive malignancy defined by extensive invasion into the local tumor microenvironment and systemic metastasis. PDAC develops in a hypoxic microenvironment and adapts to survive under low oxygen conditions, including the activation of processes that may enhance the ability of cancer cells to invade locally or metastasize. Here we employ bulk RNA-sequencing of eight patient-derived organoid (PDO) cultures grown in hypoxia and normoxia to identify differentially expressed genes. PDOs were grown in Matrigel, transferred into collagen domes, then incubated in hypoxia or normoxia. Invasive organoids were individually collected from collagen domes grown in hypoxia and normoxia separately and processed for RNA-sequencing analysis. Using this dataset, prolyl 4-hydroxylase subunit alpha (P4HA1) was identified as a potential regulator of PDAC invasion in hypoxia. This dataset exists as a reference for gene expression of invasive organoids in hypoxia and normoxia.

  Study phs003961

• Childhood Cancer Data Initiative (CCDI): Pediatric In Vivo Testing Program –Sarcoma, Kidney, and Liver Cancers

  The goal was to complete whole exome sequencing (WES) and RNA sequencing (RNA-Seq) on patient derived xenograft samples. Cancer in children is rare with approximately 15,700 new cases diagnosed annually in children 21 years or younger in the U.S. Through use of multimodality therapy (surgery, radiation therapy, and aggressive chemotherapy), 70% of patients will be 'cured' of their disease, and 5-year Event-Free Survival (EFS) exceeds 80%. Consequently, the number of patients that can be enrolled in phase I/II clinical trials is small, and most patients will have been extensively treated, hence drug/radiation resistant. Thus, preclinical studies that accurately translate into effective clinical therapy are an essential component of pediatric drug development. Our group has contributed to studies in the Pediatric Preclinical Testing Program (PPTP) and Pediatric Preclinical Testing Consortium (PPTC) that have led to clinical studies through Children's Oncology Group (COG). Of importance, we have developed and characterized over 330 Patient Derived Xenografts (PDX), developed from tumors both at diagnosis and relapse, that can be used to facilitate pediatric drug development as directed by FDA under the Research to Accelerate Cures and Equity for Children Act (RACE for Children Act).

  Study phs003160

• Dac for "Molecularly matched targeted therapies plus radiotherapy in patients with newly diagnosed glioblastoma without MGMT promoter hypermethylation (N2M2/NOA-20 phase I/IIa umbrella trial)" with PD Dr. med. Tobias Kessler, t.kessler@dkfz.de/ Prof. Dr. med. Wolfgang Wick, wolfgang.wick@med.uni-heidelberg.de

  Dac EGAC00001003521