21170 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The process was smooth and quick..ivNx"

in 37.71 milliseconds.

• cfDNA dataset for cfDNA cohort

  Cell free DNA sequencing data for 233 samples across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000104

• Targeted sequencing analysis for MDS with HSCT

  Targeted capture sequencing for cases with MDS who were subjected to unrelated bone marrow transplantation via Japan marrow donor program

  Study EGAS00001001949

• Whole genome and RNA-sequencing in T-cell acute lymphoblastic leukemia

  Dataset includes whole genome and transcriptomic sequencing data from five T-cell acute lymphoblastic leukemia (T-ALL) patients. Whole genome sequencing has performed from both diagnostic (T-ALL sample) and control (remission sample) samples. RNA-sequencing has performed from diagnostic samples. Samples has been taken from the bone marrow or peripheral blood.

  Dataset EGAD00001008658

• monozygotic twin discordant for schizophrenia

  monozygotic twin discordant for schizophrenia

  Dataset EGAD00001000048

• Data access committee for RNA-seq as a tool for evaluating human embryo competence

  Dac EGAC00001001215

• DKFZ-St.Jude Medulloblastoma - 41 MB germline cases, exome data

  Germline exome tumor/control pairs for 41 medulloblastoma cases, MBG cohort sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006658

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Longitudinal multi-omics support immunotrhrombosis as the molecular force behind increased post-acute complication risk

  Whole blood transcriptome profiles in severe COVID-19 patients (n=81) across three timepoints: A) 1st day of hospital admission, B) one month (38.46 ± 12.89 days) post-hospitalization, and C) three months post-infection (96.29 ± 13.81 days post-hospitalization). 62 patients had blood collected at all three timepoints (19 patients have transcriptome data from two timepoints (acute phase (timepoint A) and recovery phase (timepoint B or C)), 224 blood transcriptomes in total.

  Study EGAS50000001430

• APL nanopore sequencing

  Nanopore sequencing for an APL patient

  Study EGAS00001005618

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003606

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003612

• Genome and transcriptome sequence data from an adenocarcimona of the lung patient

  Genome and transcriptome sequence data from an adenocarcimona of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003616

• Genome and transcriptome sequence data from a mucinous colloid carcinoma of the pancreas patient

  Genome and transcriptome sequence data from a mucinous colloid carcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004598

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004627

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004619

• Genome and transcriptome sequence data from a metastatic mmmt of the endometrium patient

  Genome and transcriptome sequence data from a metastatic mmmt of the endometrium patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004618

• Genome and transcriptome sequence data from a ganglioglioma of the left temporal lobe patient

  Genome and transcriptome sequence data from a ganglioglioma of the left temporal lobe patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004615

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004634

• Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the breast patient

  Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the breast patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004921

• Genome and transcriptome sequence data from a squamous cell carcinoma of the alveolar ridge patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the alveolar ridge patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004934

• Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx tumor patient

  Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015307

• Deep_sequencing_of_melanoma_for_driver_mutations

  Deep sequencing of melanoma for driver mutations

  Study EGAS00001000857

• Single-nucleus Transcriptome of Down Syndrome Brains (short-read)

  29 DS and Control brain samples were prepared using the 10X Genomics Single Cell 3' v3 kit. The cDNA libraries were sequenced on an Illumina Novaseq 6000.

  Dataset EGAD00001008287

• Whole-exome sequencing laser capture micro-dissected biopsies of human renal cell carcinoma

  The dataset comprises whole exome sequences from laser capture micro-dissected biopsies of 10 patients diagnosed with clear cell renal cell carcinoma. In total over 100 regions are sampled to allow 'focally exhaustive' sequencing and explore the limits of intra-tumoural heterogeneity.

  Dataset EGAD00001008029

• snRNA-seq BAM files from 10x Multiome profiling of human fetal liver hematopoiesis

  This dataset provides snRNA-seq BAM files from a single-nucleus multiome study of 53 human fetal liver samples (5–18 post-conception weeks). Live CD45+CD235- cells were sorted from dissociated tissue, and isolated nuclei were processed using the Chromium Next GEM Single Cell Multiome ATAC + Gene Expression kit. Raw sequencing data were processed and aligned to GRCh38-2020-A-2.0.0 using Cell Ranger ARC v2.0.2.

  Dataset EGAD50000002337

• Genome and transcriptome sequence data from a metastatic colorectal carcinoma patient

  Genome and transcriptome sequence data from a metastatic colorectal carcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001307

• Genome and transcriptome sequence data from a primary unknown cancer patient

  Genome and transcriptome sequence data from a primary unknown cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001308

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002534

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002531

• Genome and transcriptome sequence data from an ovarian cancer patient

  Genome and transcriptome sequence data from an ovarian cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002533

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002532

• Genome and transcriptome sequence data from a uterine sarcoma patient

  Genome and transcriptome sequence data from a uterine sarcoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002538

• Genome and transcriptome sequence data from a cholangiocarcinoma patient

  Genome and transcriptome sequence data from a cholangiocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002537

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002536

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002535

• Candidate diagnostic variants reported into DECIPHER, Wright NEJM 2023

  Candidate diagnostic variants reported into DECIPHER by 4 April 2022, annotated with clinical and automated pathogenicity assertions (see DOI: 10.1056/NEJMoa2209046). Genomic Diagnosis of Rare Pediatric Disease in the United Kingdom and Ireland, Wright et al, NEJM 2023.

  Dataset EGAD00001010137

• BLUEPRINT September 2016, ATAC-seq for osteoclast from venous blood, on Genome GRCh38

  ATAC-seq data for 2 sample(s) for osteoclast from venous blood, on Genome GRCh38. 2 run(s), 2 experiment(s), 2 alignment(s). Part of BLUEPRINT (September 2016).

  Dataset EGAD00001002907

• BLUEPRINT September 2016, ATAC-seq Multiple Myeloma for plasma cell from bone marrow, on Genome GRCh38

  ATAC-seq data for 4 sample(s) Multiple Myeloma for plasma cell from bone marrow, on Genome GRCh38. 4 run(s), 4 experiment(s), 4 alignment(s). Part of BLUEPRINT (September 2016).

  Dataset EGAD00001002920

• BLUEPRINT September 2016, ATAC-seq for plasma cell from tonsil, on Genome GRCh38

  ATAC-seq data for 2 sample(s) for plasma cell from tonsil, on Genome GRCh38. 2 run(s), 2 experiment(s), 2 alignment(s). Part of BLUEPRINT (September 2016).

  Dataset EGAD00001002912

• BLUEPRINT September 2016, ATAC-seq for naive B cell from tonsil, on Genome GRCh38

  ATAC-seq data for 3 sample(s) for naive B cell from tonsil, on Genome GRCh38. 3 run(s), 3 experiment(s), 3 alignment(s). Part of BLUEPRINT (September 2016).

  Dataset EGAD00001002903

• WGS minibam files for SJLIFE

  WGS minibam files for SJLIFE

  Dataset EGAD00001003396