19249 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 25.17 milliseconds.

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• WES Analysis of CRC and UC samples from a cohort of Lynch Syndrome carriers

  Whole-exome sequencing (WES) was performed on 73 tumors, including 58 colorectal cancers (CRC) and 15 urothelial cancers (UC), derived from 58 individuals with Lynch syndrome (LS). The cohort comprised both primary and metachronous tumors.

  Dataset EGAD50000001915

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• WES sequencing data from 8 classical Hodgkin Lymphoma tumors and 8 corresponding normal samples

  To delineate the mutational landscape of classical Hodgkin Lymphoma Whole Exome sequencing (WES) was performed on HRS cells isolated from classical Hodgkin Lymphoma tumors and corresponding normal samples (n=8)

  Dataset EGAD50000002164

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522