19229 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 68.57 milliseconds.

• Landscape of somatic mutations and DNA copy number alterations and transcriptomic profiling identifies metabolic reprogramming as a hallmark of ibrutinib resistance

  Whole-exome sequencing (WES) was conducted on the clinical specimens of 14 cases that had sufficient isolated tumor DNA, including 7 ibrutinib-sensitive cases and 7 ibrutinib-resistant cases. Whole transcriptome sequencing (RNA-seq) was performed on clinical specimens isolated from 14 ibrutinib-sensitive and 7 ibrutinib-resistant cases. Unsupervised hierarchical clustering of MCL tumors using RNA-seq gene expression data showed a response-specific gene expression signature.

  Study EGAS00001003418

• Functional analysis of GATA2 synonymous mutations

  Germline mutations in SAMD9 and SAMD9L (SAMD9/9L) genes predispose to myelodysplastic syndromes (MDS) and show high prevalence in pediatric MDS with monosomy 7. Here, we studied an international cohort of children with primary MDS to assess the prevalence, hematological features, genetics, clonal evolution and clinical outcome in patients with germline SAMD9/9L mutations compared to pediatric MDS with either germline GATA2 mutations or pediatric MDS with wildtype status in SAMD9/9L and GATA2 genes

  Study EGAS00001003817

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - patient metadata files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - patient metadata files (Mutographs)

  Dataset EGAD00001015387

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - structural variation vcf files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - structural variation vcf files (Mutographs)

  Dataset EGAD00001015389

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - copy number variants (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - copy number variants (Mutographs)

  Dataset EGAD00001015390

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - filtered vcf files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - filtered vcf files (Mutographs)

  Dataset EGAD00001015388

• Colorctal cancer WES/WGS analysis in Dr. Liu’s group in Sun Yat-sen University Cancer Center.

  The samples include paired tumor and normal tissues from 106 patients . High-coverage WES sequencing or whole genome sequencing of DNA samples were performed on the Illumina HiSeq 2000 system

  Dataset EGAD00001003551

• Intercellular nanotube-mediated mitochondrial transfer enhances T-cell metabolic fitness and antitumor efficacy

  We found that bone marrow-derived mesenchymal stromal cells (MSC) establish nanotubular connections with T cells in a Talin 2 (TLN2)-dependent manner and leveraged these intercellular highways to supply new mitochondria to CD8+ T cells. In this experiment we analyzed the transcriptional profile of T cells co-cultured with MSC containing MSC derived Mitochondria (MitoPositive), T cells co-cultured with MSC not containing MSC derived Mitochondria and control T cells.

  Study EGAS00001007356

• NEC

  This multi-centre, non-randomized, open-label, phase II trial (NCT03016338), assessed niraparib monotherapy (cohort 1, C1), or niraparib and dostarlimab (cohort 2, C2) in patients with recurrent serous or endometrioid endometrial carcinoma. The primary endpoint was clinical benefit rate (CBR). Secondary outcomes were safety and objective response rate (ORR). Translational research was an exploratory outcome. Potential biomarkers were evaluated in archival tissue by immunohistochemistry and next generation sequencing panel. Feasibility of liquid biopsy by ctDNA was assessed.

  Study EGAS00001007013

• Genome-wide analysis of H3K27me3 occupancy and DNA methlytion in pediatric high-grade glioma

  Genome-wide analysis of H3K27me3 occupancy and DNA methylation in K27M-mutant and H3.3-WT primary pediatric high-grade gliomas (pHGGs) as well as pediatric pHGG cell lines. The study aims to elucidate the connection between K27M-induced H3K27me3 reduction and changes in DNA methylation as well as gene expression.

  Dataset EGAD00001000677

• Targeted exome DNA sequencing of matched brain tumor-normal pairs (ICGC)

  Illumina HiSeq sequence data (with >80x coverage) were aligned to the hg19 human reference genome assembly using BWA (Li and Durbin, 2009); duplicate reads were removed from the final BAM file. No realignment or recalibration was performed.

  Dataset EGAD00001000699

• Myeloproliferative Neoplasms (MPN) Targeted Gene Screen

  Pulldown experiments will be performed on a number of patients with Myeloproliferative Neoplasms (MPN). The pulldown will be a bespoke design targeting known mutations, this pulldown will be sequenced and analysed to inform prevalence of mutations and to inform to the possibility of use as a diagnostic tool.

  Dataset EGAD00001000652

• Matched Pair Cell Line Tumour RNAseq

  In this study we will sequence the transcriptome of Verified Matched Pair Cancer Cell line tumour samples. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000630

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  We investigated 10 female and 14 male SARS-CoV-2 positive children (age range: 0.8 to 18 years). Based on the WHO guidelines, 15 patients were classified as having mild COVID-19, while 7 children were classified as moderate COVID-19 cases. Two children were asymptomatic. 8 female and 10 male SARS-CoV-2 negative children were included as controls (age range: 4 to 16). 12 SARS-CoV-2 positive female and 9 male adults were included ( age range: 27 - 76) together with 13 female and 10 male SARS-CoV-2 negative adult controls (age: 24 - 77). 10 adult COVID-19 patients had mild disease, while 12 had moderate COVID-19. We performed single-cell RNA sequencing experiments.

  Dataset EGAD00001007969

• De novo metastatic prostate cancer cohort

  Fastq files from RNA sequencing of normal and tumor samples from 16 patients from the de novo metastatic prostate cancer cohort.

  Dataset EGAD50000002381

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Enzymatic methylation sequencing of intestinal metaplasia

  We perform genome-wide EM-seq of 14 patients with concurrent matched normal, dysplasia and early gastric samples from South Korea. The dataset contains cram files from 38 samples.

  Dataset EGAD50000001538

• Single cell transcriptomes from vascularized human retinal organoids

  Both control and vascularized organoids were processed using the 10x Chromium 3' RNA method. Sequencing reads were aligned with STARsolo.

  Dataset EGAD50000001216

• FOCUS study

  Shallow whole genome sequencing of adavanced colorectal tumors from patients included in the FOCUS clinical trial. Performed to calculate assocations of irinotecan with copy-number alterations. Copy number aberration analysis of 349 enroled patients.

  Dataset EGAD50000001007

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• H3K27me3 Cut&Tag on beta cells

  H3K27me3 Cut&Tag datasets in human pancreatic islets and the EndoC-bH1 cell line

  Dataset EGAD50000000463

• H3Africa EPIGEN EWAS

  Data from 59 whole blood samples from pregnant mothers, unexposed and exposed to the Rwandan genocide, was generated using Infinium MethylationEPIC BeadChip Kit.

  Dataset EGAD00010002383

• H3Africa SIREN GWAS Stroke

  3421 Samples from Nigeria and Ghana, genotyped with the Illumina NestSeq 500

  Dataset EGAD00010002551

• RP3_Freeze_1

  Freeze 1 of the RP3 project

  Dataset EGAD00010000887

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• EGAD00000000057

  WTCCC project samples from the Parkinson's disase cohort

  Dataset EGAD00000000057

• Long-read sequence data from two carriers of a predisposing structural variant

  This dataset contains PacBio long-read sequence data from two individuals with a chr9p.21 structural variant and two controls. Sequences were aligned againt the human reference genome HG38.

  Dataset EGAD50000002155

• Germline WES data of parents whose children have germline CHEK2 mutations

  This data set includes bam files (aligned to hg38) from the germline of parents whose children have CHEK2 germline mutations.

  Dataset EGAD00001009516

• Germline WES data of children with pathogenic mutations in cancer predisposing genes

  This data set includes bam files (aligned to hg38) from the germline of children who have pathogenic mutations in cancer predisposing genes

  Dataset EGAD00001009854

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• The University of Hong Kong Intestinal Metaplasia Organoids Study scRNASeq Data

  Single cell encapsulation and cDNA libraries were prepared by Chromium™ Single Cell 5’ Reagent Kits and Chromium™ Single Cell A Chip Kit.

  Dataset EGAD00001015422

• HIPO blastemal Wilms (nephroblastoma) CHIP sequencing samples

  HIPO blastemal Wilms (nephroblastoma) characterisation of tumor driving events caused by differential SIX1 binding of the SIX1 Q177R mutatns

  Dataset EGAD00001000992

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• Whole exome sequencing of Finnish hereditary breast cancer families

  Dataset contains Whole Exome Sequencing(WES) data from 37 individuals as aligned bam-files. The reads have been aligned using bowtie2 to human genome hg19 build.

  Dataset EGAD00001002133

• cHCC-ICC WES

  The whole exome sequencing data of 291 tumor/normal samples from 121 cHCC-ICC cases.

  Dataset EGAD00001005183

• WES data from optic atrophy study

  The dataset includes Fastq files from WES experiments performed on a proband presenting with syndromic optic atrophy and his healthy parents. Exons were captured by hybridization and sequenced on an Illumina platform

  Dataset EGAD00001005321

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• postcovid19

  contain the raw data from scRNA, scATAC, genotyping.

  Dataset EGAD00001008122

• Gain of Function Mutations in RPA1

  Exome sequencing and amplicon-based single-cell sequencing dataset on the patients and family members that were analyzed in this study.

  Dataset EGAD00001008329

• Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the palate patient

  Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the palate patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003065

• Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient

  Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003702

• Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient

  Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003716

• Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003723

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003725

• Genome and transcriptome sequence data from a spindle cell carcinoma of the left parotid patient

  Genome and transcriptome sequence data from a spindle cell carcinoma of the left parotid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003734

• Genome and transcriptome sequence data from an adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from an adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003742

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495