19073 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 28.89 milliseconds.

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004640

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the ge junction patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the ge junction patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003673

• Genome and transcriptome sequence data from a metastatic mucinous adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic mucinous adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003669

• Genome and transcriptome sequence data from an adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from an adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003657

• Genome and transcriptome sequence data from a metastatic ductal carcinoma of the breast patient

  Genome and transcriptome sequence data from a metastatic ductal carcinoma of the breast patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003016

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003012

• Genome and transcriptome sequence data from a squamous cell carcinoma of the lung patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003011

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003005

• Genome and transcriptome sequence data from a metastatic large cell neuroendocrine tumour of the lung patient

  Genome and transcriptome sequence data from a metastatic large cell neuroendocrine tumour of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003017

• Genome and transcriptome sequence data from a carcinosarcoma of the uterus patient

  Genome and transcriptome sequence data from a carcinosarcoma of the uterus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002995

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the GE junction patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the GE junction patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002595

• The Cleveland Clinic Foundation's (CCF) Lone Atrial Fibrillation (AFIB) GWAS Study

  Blood samples were taken from patients who have lone atrial fibrillation. DNA samples were processed with Illumina Hap550 and Hap 610 chips.

  Study phs000820

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• To determine the genomic profile of Triple Negative Breast Cancer patient-derived xenografts (PDX cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (PDX_WGS)

  Study EGAS00001005995

• WES Analysis of CRC and UC samples from a cohort of Lynch Syndrome carriers

  Whole-exome sequencing (WES) was performed on 73 tumors, including 58 colorectal cancers (CRC) and 15 urothelial cancers (UC), derived from 58 individuals with Lynch syndrome (LS). The cohort comprised both primary and metachronous tumors.

  Dataset EGAD50000001915

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• WES sequencing data from 8 classical Hodgkin Lymphoma tumors and 8 corresponding normal samples

  To delineate the mutational landscape of classical Hodgkin Lymphoma Whole Exome sequencing (WES) was performed on HRS cells isolated from classical Hodgkin Lymphoma tumors and corresponding normal samples (n=8)

  Dataset EGAD50000002164

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• CRC cell line MPRA

  Massively Parallel Reporter Assays (MPRA) of colorectal cell lines HCEC-1CT (normal colon) and HT29 and SW403 (MSS cancer). Probes identified using the CRC GWAS.

  Dataset EGAD50000000596

• Single-cell RNA and TCR-sequencing of treatment-refractive immune-mediated arthritis

  Single-cell RNA and TCR-sequencing of three patients with treatment-refractive immune-mediated arthritis. The dataset consists of synovial tissue CD4+ and CD8+ T cells and peripheral blood CD45+ leukocytes.

  Dataset EGAD50000000749