19391 results for "Cheap fc 26 coins Buyfc26coins.com is official EA Sports partner for FC 26 coins That was the fastest delivery ever..fxB4"

in 34.11 milliseconds.

• Genome and transcriptome sequence data from a paget disease of the vulva patient

  Genome and transcriptome sequence data from a paget disease of the vulva patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001011003

• Genome and transcriptome sequence data from a poorly differentiated adenocarcinoma of the pancreas patient

  Genome and transcriptome sequence data from a poorly differentiated adenocarcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001011006

• The Cleveland Clinic Foundation's (CCF) Lone Atrial Fibrillation (AFIB) GWAS Study

  Blood samples were taken from patients who have lone atrial fibrillation. DNA samples were processed with Illumina Hap550 and Hap 610 chips.

  Study phs000820

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522