19375 results for "Cheap fc 26 coins Buyfc26coins.com is official EA Sports partner for FC 26 coins That was the fastest delivery ever..fxB4"

in 40.86 milliseconds.

• Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient

  Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003702

• Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient

  Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003716

• Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003723

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003725

• Genome and transcriptome sequence data from a spindle cell carcinoma of the left parotid patient

  Genome and transcriptome sequence data from a spindle cell carcinoma of the left parotid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003734

• Genome and transcriptome sequence data from an adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from an adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003742

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• PacBio HiFi whole-genome sequencing of two microsatellite instability (MSI) gastric cancer

  We generated long-read whole-genome sequencing (WGS) data using PacBio HiFi from two human gastric cancer cell lines exhibiting microsatellite instability (MSI). The dataset contains aligned bam (hg38) files.

  Dataset EGAD50000002300

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Long-read RNA-seq from 5 patients with stereotyped subset CLL

  Oxford Nanopore Technologies based long-read RNA sequencing data from 5 patients with stereotyped subset CLL. The BAM files were aligned against hg19 reference genome.

  Dataset EGAD50000000755

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Methylation profiling of sarcoma and TFCP2-rearranged rhadomyosarcoma samples

  Methylation profiling of 345 sarcoma and TFCP2-rearranged rhadomyosarcoma samples, using the approach described "Genomic, transcriptomic, functional, and mechanistic characterization of rhabdomyosarcoma with FUS-TFCP2 or EWSR1-TFCP2 fusions"

  Dataset EGAD00010002451

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• The temporal mutational and immune tumour microenvironment remodelling of HER2-negative primary breast cancers

  WES and clonality characterization of different timepoints in HER2-negative primary breast cancers receiving neoadjuvant eribulin therapy.

  Study EGAS00001004953

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• Deep Sequencing of somatic cancer mutations

  We enriched a panel of cancer associated genes using the Custom Sure Select Target Enrichment Kit. Identified mutations were validated with deep sequencing in order to assess mutated allele frequencies more accurately.

  Dataset EGAD00001001313

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305