20311 results for "Fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are efficient and quick always..Z2Xg"

in 58.45 milliseconds.

• CBD-KEY-SUMMARIES: Other data

  Other raw and processed phenotype data generated by the COMBAT consortium.

  Dataset EGAD00001008009

• Long cell-free DNA molecules in maternal plasma (dataset1)

  Bam files consists PET cases and healthy cases

  Dataset EGAD00001008721

• Single-cell RNA sequencing

  Single-cell RNA sequencing on 10 antrum and 4 body gastric biopsies

  Dataset EGAD00001010166

• Gene expression associated with Klinefelter syndrome

  RNA-sequencing profiling of leucocytes from peripheral blood samples from 9 KS patients, 9 control males and 13 female controls

  Dataset EGAD00001010078

• Smart-seq2 single-cell RNA-seq of human liver non-parenchymal cells

  Smart-seq2 single-cell RNA-seq of human liver non-parenchymal cells from lean and obese individuals

  Dataset EGAD00001010301

• PrevANZ RNAseq dataset

  Whole blood samples collected at baseline and week 12 in PAXgene Blood RNA tubes. RNA sequencing on the Illumina NovaSeq 6000 System generated 150 base pair length paired end reads.

  Dataset EGAD00001011069

• The University of Hong Kong Intestinal Metaplasia Organoids Study WES Data

  Whole exome sequencing data generated from organoid cultures established from normal gastrointestinal organoids, long-term, spheroid and blood leukocyte DNA.

  Dataset EGAD00001015420

• KIT-dependent and -independent genomic heterogeneity of resistance in gastrointestinal stromal tumors - TORC1/2 inhibition as salvage strategy

  The mutational status of GIST analyzed with a broad sequencing approach (WES, RNAseq)

  Study EGAS00001003405

• WGS of HSPC clones of healthy individual sequenced with Illumina NovaSeq 6000

  Dataset contains WGS sequecing data from clonally expanded hematopoietic stem cells from 7 individual pediatric cancer patients. Samples were taken before (DX - diagnosis) or Follow-up (DX2/REM/FU - Diagnosis 2, remission or follow-up, respectively). In addtion, cord blood clones (Designated CB) treated with X-ray radiation, Cisplatin, Maphosphamide, Vincristine and Doxorubicin and untreated cord blood hematopoietic stem/progenitor cells were have been whole-genome sequenced. (Abbreviations RAD, CISPL, MAPH, VINC, DOX and CTRL, respectively)

  Dataset EGAD00001007078

• RNA-seq data

  RNAseq FASTq files of 181 bulk pre-treatment and 14 post-treatment tumors from GO30140 Ph1b group A and F and 177 bulk pre-treatment tumors of IMbrave150 PhIII

  Dataset EGAD00001008128

• Adult B-precursor acute lymphoblastic leukemia transcriptomes

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of B-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Dataset EGAD00001008633

• De novo metastatic prostate cancer cohort

  Fastq files from RNA sequencing of normal and tumor samples from 16 patients from the de novo metastatic prostate cancer cohort.

  Dataset EGAD50000002381

• Repertoire sequencies from three different protocols

  This dataset contains sequencing data from Bulk RNAseq, PCR-based RepSeq and SMRT sequencing to compare immunoglobulin repertoire profiling strategies using matched human B-cell samples

  Dataset EGAD50000002217

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Enzymatic methylation sequencing of intestinal metaplasia

  We perform genome-wide EM-seq of 14 patients with concurrent matched normal, dysplasia and early gastric samples from South Korea. The dataset contains cram files from 38 samples.

  Dataset EGAD50000001538

• Holistic ends analysis

  This dataset comprises fastq or bam files derived from sequencing data of dsDNA and ssDNA libraries from 138 plasma cfDNA samples.

  Dataset EGAD50000001737

• Single cell transcriptomes from vascularized human retinal organoids

  Both control and vascularized organoids were processed using the 10x Chromium 3' RNA method. Sequencing reads were aligned with STARsolo.

  Dataset EGAD50000001216

• Dataset of Clonal Evolution of PPM1D Mutations in the Spectrum of Myeloid Disorders

  This dataset contains genomic profiles of 7 PPM1D-mutated patients across the spectrum of myeloid disorders using single-cell analyses (Tapestri technology) on diagnostic and longitudinal samples.

  Dataset EGAD50000001229

• Short-read transcriptomic data

  Short-read transcriptomic data of unaffected control, expansion negative, and expansion positive FECD CECs

  Dataset EGAD50000000436

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• H3K27me3 Cut&Tag on beta cells

  H3K27me3 Cut&Tag datasets in human pancreatic islets and the EndoC-bH1 cell line

  Dataset EGAD50000000463

• H3Africa EPIGEN EWAS

  Data from 59 whole blood samples from pregnant mothers, unexposed and exposed to the Rwandan genocide, was generated using Infinium MethylationEPIC BeadChip Kit.

  Dataset EGAD00010002383

• H3Africa SIREN GWAS Stroke

  3421 Samples from Nigeria and Ghana, genotyped with the Illumina NestSeq 500

  Dataset EGAD00010002551

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• Long-read sequence data from two carriers of a predisposing structural variant

  This dataset contains PacBio long-read sequence data from two individuals with a chr9p.21 structural variant and two controls. Sequences were aligned againt the human reference genome HG38.

  Dataset EGAD50000002155

• Locally advanced rectal cancer samples

  Fastq files from exome sequencing of paired normal/tumor (pre and post-nCRT) samples from 7 patients with rectal tumors. All samples were sequenced on a 5500xl SOLiD sequencing platform (Thermo Fisher Scientific).

  Dataset EGAD00001004378

• Tumor-associated preferred end coordinates and somatic variants as signatures of circulating tumor DNA

  Plasma DNA libraries were constructed from 4 mL of plasma without library enrichment, namely without PCR amplification. Paired-end massively parallel sequencing was performed

  Dataset EGAD00001004561

• Cell lines with telomere fusion-induced rearrangements

  Whole-genome somatic rearrangement and point mutation analysis in cell lines with induced telomere fusions.

  Dataset EGAD00001001629

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• whole genome sequencing

  Whole-genome sequencing was performed by Illumina Inc (San Diego, CA). Libraries were constructed with ~300bp insert length and paired-end 100bp reads were sequenced on Illumina HiSeq2000.

  Dataset EGAD00001000782

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• BAM files of evolution T-ALL adults project

  WGS BAMs of 19 adult patients with T-acute lymphoblastic leukemia with primary, remission and relapse sample per patient. Total = 58 samples sequenced with HiSeq 4000 or NovaSeq 6000 (Illumina).

  Dataset EGAD00001006543

• WGS-TOF study

  Whole genome sequencing data (bam) of tetralogy of Fallot study, including data derived from iPSCs of two control and four patients with tetralogy of Fallot (two with DiGeorge syndrome (DG), two without DiGeorge syndrome (ND).

  Dataset EGAD00001008569

• Paired-end Whole Exome-seq analysis of TERT promoter duplication in GBM

  Dataset contains paired-end Whole Exome sequencing data from 5 tumor samples and 1 single normal blood sample from a single primary GBM patient.

  Dataset EGAD00001008768

• RNA sequencing of human lung fibroblasts

  Bulk RNA seq data from human lung fibroblasts isolated from fresh and cryopreserved lung tissue (18 samples, 3 donors)

  Dataset EGAD00001010252

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• Single-cell CITE-seq from MDS patients with SF3B1 mutations

  Single-cell CITE(cellular indexing of transcriptomes and epitopes)-seq from MDS (n = 2, MDS02 in 2 replicates). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011281

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Multi-omics Profiling of Asian Breast Cancers

  186 tumor/normal matched samples from whole exome sequecing and 178 samples (168 tumors, 10 normals) from whole transcriptome sequencing

  Dataset EGAD00001003776

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326