20311 results for "Fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are efficient and quick always..Z2Xg"

in 36.38 milliseconds.

• WGS and RNA-Seq data from a GBM patient PT-EV3071

  WGS and RNA-Seq data from a GBM patient PT-EV3071

  Dataset EGAD00001004234

• Single-cell T-cell receptor sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell T-cell receptor sequencing (scTCR-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007014

• WGS and RNA-Seq data from a GBM patient PT-WR7927

  WGS and RNA-Seq data from a GBM patient PT-WR7927

  Dataset EGAD00001008531

• WGS and RNA-Seq data from a GBM patient PT-GI2070

  WGS and RNA-Seq data from a GBM patient PT-GI2070

  Dataset EGAD00001008520

• WGS and RNA-Seq data from a GBM patient PT-JR9883

  WGS and RNA-Seq data from a GBM patient PT-JR9883

  Dataset EGAD00001008521

• WGS and RNA-Seq data from a GBM patient PT-LC6372

  WGS and RNA-Seq data from a GBM patient PT-LC6372

  Dataset EGAD00001008522

• WGS and RNA-Seq data from a GBM patient PT-ML9537

  WGS and RNA-Seq data from a GBM patient PT-ML9537

  Dataset EGAD00001008523

• WGS and RNA-Seq data from a GBM patient PT-RV2286

  WGS and RNA-Seq data from a GBM patient PT-RV2286

  Dataset EGAD00001008527

• WGS and RNA-Seq data from a GBM patient PT-WT4796

  WGS and RNA-Seq data from a GBM patient PT-WT4796

  Dataset EGAD00001008532

• WGS and RNA-Seq data from a GBM patient PT-DM9089

  WGS and RNA-Seq data from a GBM patient PT-DM9089

  Dataset EGAD00001008518

• WGS and RNA-Seq data from a GBM patient PT-BM8772

  WGS and RNA-Seq data from a GBM patient PT-BM8772

  Dataset EGAD00001008516

• WGS and RNA-Seq data from a GBM patient PT-CM3220

  WGS and RNA-Seq data from a GBM patient PT-CM3220

  Dataset EGAD00001008517

• WGS and RNA-Seq data from a GBM patient PT-GE7528

  WGS and RNA-Seq data from a GBM patient PT-GE7528

  Dataset EGAD00001008519

• WGS and RNA-Seq data from a GBM patient PT-PR5617

  WGS and RNA-Seq data from a GBM patient PT-PR5617

  Dataset EGAD00001008525

• RNA-seq of high-grade serous ovarian cancer in long-term survivors (MOCOG study)

  RNA-seq dataset of high-grade serous ovarian cancer (HGSC) tumours from long-term survivors performed as part of the Multidisciplinary Ovarian Cancer Outcomes Group (MOCOG) study. The dataset includes fastq files from 56 HGSC tumours (53 primary tumours and 3 recurrent tumours) from 53 long-term survivor patients. Libraries were generated using the Illumina Stranded mRNA Prep and 150 bp paired-end sequencing was performed to a minimum of 100 million reads on Illumina NovaSeq 6000 instruments.

  Dataset EGAD00001008537

• Genome and transcriptome sequence data from a myoepithelioma patient

  Genome and transcriptome sequence data from a myoepithelioma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010938

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010940

• Genome and transcriptome sequence data from a leiomyosarcoma patient

  Genome and transcriptome sequence data from a leiomyosarcoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010939

• Genome and transcriptome sequence data from a melanoma patient

  Genome and transcriptome sequence data from a melanoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010943

• Genome and transcriptome sequence data from a pancreatic cancer patient

  Genome and transcriptome sequence data from a pancreatic cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010945

• Genome and transcriptome sequence data from a cervical cancer patient

  Genome and transcriptome sequence data from a cervical cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010947

• Genome and transcriptome sequence data from a pancreatic cancer patient

  Genome and transcriptome sequence data from a pancreatic cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010948

• Genome and transcriptome sequence data from a endometrial adenocarcinoma patient

  Genome and transcriptome sequence data from a endometrial adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010949

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010951

• Genome and transcriptome sequence data from a uveal melanoma patient

  Genome and transcriptome sequence data from a uveal melanoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010956

• Genome and transcriptome sequence data from a leiomyosarcoma patient

  Genome and transcriptome sequence data from a leiomyosarcoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010957

• Genome and transcriptome sequence data from a metastatic melanoma patient

  Genome and transcriptome sequence data from a metastatic melanoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010958

• Genome and transcriptome sequence data from a metastatic adenocarcinoma patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010960

• Genome and transcriptome sequence data from a pancreas adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreas adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010963

• hereditary BrEAst Case CONtrol study (BEACCON)

  The BEACCON study aimed to address the lack of power of previous studies to identify novel BC predisposition genes by performing extensive sequencing in 12,000 women (11,511 analysed following exclusions) and further enhancing power by using an ‘extreme phenotype’ design with enrichment of familial non-BRCA1 and BRCA2 cases, compared with a control population of older women with ongoing confirmation of cancer-free status at June 2019. Three-quarters of the 1303 candidate genes screened were selected based on empiric evidence from local (69 multi-case BC families) or international whole exome sequencing studies, and the remainder were included to provide detailed coverage of functional pathways with established associations with BC.

  Dataset EGAD00001007025

• ChIIP-seq and RNA-seq

  epigenome profiling in tumor tissues and paired normal tissues of LUAD patients and transcriptome profiling in tumor tissues of LUAD patients.

  Dataset EGAD00001007066

• The Dutch Microbiome Project Batch 1

  The Dutch Microbiome Project (DMP) data includes shotgun metagenomic sequencing of faecal samples 8,208 Dutch individuals. Paired-end sequencing was performed using Illumina HiSeq 2000 platform. Data is archived in two batches to facilitate easier data access and upload to EGA. Batch 1 of DMP includes 4396 samples.

  Dataset EGAD00001007027

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• RNA Dataset

  The RNA dataset includes 5 samples analyzed with the Oncomine Comprehensive Assay (OCA) panel. After library preparation, sequencing was performed on the Ion Torrent S5 System, generating FASTQ files. The analysis captures gene fusions and splice variants relevant to oncogenic processes. (idem)

  Dataset EGAD50000002502

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• This dataset contains the cram files from the whole Exome sequencing

  Exome Sequencing of Healthy and M. Heamophilum Infected Participants

  Dataset EGAD50000001565

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• Single-cell RNA/ATAC multiome profiling of hepatoblastoma resection samples

  10x Genomics Chromium Next GEM Single Cell Multiome ATAC + Gene Expression data of hepatoblastoma tissue samples. BAM files containing sequencing data of resection material of PT13 and PT17.

  Dataset EGAD50000001750

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805