3743 results for "RNA AND sequencing OR transcriptome"

in 7.59 milliseconds.

• Genomic analysis of pancreatic neuroendocrine tumour with MEN1, ATRX, or DAXX mutations

  This dataset includes 52 samples from 19 individuals with pancreatic neuroendocrine tumours. These samples were analyzed using RNA-sequencing, whole-exome sequencing, shallow (~0.3x) whole-genome sequencing, and a 21-gene panel targeted capture sequencing. Everything was sequenced using the Illumina HiSeq and is provided in BAM or FASTQ format.

  Dataset EGAD00001006001

• MuTHER_adipose_tissue_small_RNA_expression

  We investigate the naturally occurring variation of small RNA expression in conjunction with genetic and gene expression variation. We shall assess the variation in subabdominal fat tissue small RNA levels in 168 unrelated MuTHER individuals. Using gene expression data from the same samples, we can survey how much the small RNA expression contributes to the variance in gene expression profiles. We can also take advantage of the high density genotyping data on these samples to identify genetic associations of small RNA expression levels, and the downstream effect of the genetic variants in small RNA sequence. Previous small RNA sequencing efforts have also extended the repertoire of small RNAs, and we hope to potentially find additional small RNAs active in adipose tissue biology. Altogether, the project should provide an exciting view into small RNA biology in humans, and lead to development of new methodology for analysis of molecular phenotype data.

  Study EGAS00001000212

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  The dataset contains bulk RNA sequencing data from 12 pediatric thymus samples collected during cardiac surgeries. These samples represent immunologically healthy donors with a mean age of 6 months. The sequencing was performed using Illumina HiSeq4000, and the processed files are available in standard formats such as FASTQ.

  Dataset EGAD50000001120

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• Epigenomics and Single-cell Sequencing Define Cellular Heterogeneity in Langerhans Cell Histiocytosis

  Epigenomic and transcriptomic analysis of Langerhans cell histiocytosis (LCH) biopsies. Single-cell RNA-seq (10x Genomics) of seven LCH biopsies. ATAC-seq data from four sorted cell populations (in duplicate) from one LCH biopsy.

  Dataset EGAD00001005280

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464