14982 results for "cancer studies using rna-seq"

in 26.18 milliseconds.

• GBM Up and Down Responder EZH2 ChIPseq

  ChIPseq using anti-EZH2 with a sheared input DNA control to assess EZH2 genomic biding in one longitudinal pair of samples (pre- and post-treatment) from one UP and one DOWN responder GBM patient

  Dataset EGAD50000000134

• Integration of T Cell Repertoire, CyTOF, genotyping and symptomatology data reveals subphenotypic variability in COVID-19 Patients

  A total of 61 patients (33 mild and 28 severe) with a median age of 51 years who recovered from COVID-19 were included in this study (Table 1). All collected samples were confirmed in diagnosis of COVID-19 by RT-PCR and positive IgG serolog. For the 61 patients, TCR-seq, CyTOF, and genotyping data were generated and analyzed in separate studies, as part of larger cohorts. In total, there are 143 variables, with 129 being quantitative (TCRseq and CyTOF metrics) and 13 being qualitative (symptomatology and genotyping). For more information about cohort characteristics, data adquisition an pre-processing, please visit PMID: 39227859, 36969980 and 37287057.

  Dataset EGAD50000000840

• Uncovering Inversion Formation in the Human Genome and its Impact to Disease

  The relevance of inversions for disease causation, speciation and adaptation is broadly recognized, although the prevalence of inversions is unknown. In humans, de novo inversions are associated with congenital anomalies in approximately 9.6% of patients. Yet, despite the biological relevance of inversions, their molecular features, formation mechanism, impact to the genomic structure of carriers, as well as their contribution to clinical phenotypes, have not been further explored. Inversions are typically classified as balanced reciprocal events generated by ectopic recombination, although recent studies reveal a distinct picture whereby inversions originate from mechanisms that concomitantly generate copy number variants (CNVs). Surprisingly, those complex inversions underlie as much as 30% of neurodevelopmental-associated CNVs. The hypothesis of this project are: inversions are often generated de novo by mechanisms other than ectopic recombination a relevant fraction of inversions are associated with complex genomic rearrangements (CGRs), often overlooked in sporadic diseases, and inversions are a "hidden" type of structural variation for which contribution to a clinical phenotypes has been under assessed due to the lack of appropriate detection tools. A combined strategy using multiple genomic tools will be applied to characterize inversions and associated genomic alterations in individuals with neurodevelopmental disorders and controls: whole genome sequencing (WGS) with short-and long-reads; genome mapping; classical cytogenetics; and array CGH. This project will establish common ground to bridge studies of rare and common diseases, human evolution, and population genetics.

  Study phs002999

• WGS of high grade serous ovarian tumours and matched blood normals

  FASTQ reads for 34 matched tumour-normal WGS pairs for high grade serous ovarian cancer patients. Scottish HGSOC samples were collected via local Bioresource facilities at Edinburgh, Glasgow, Dundee and Aberdeen and stored in liquid Nitrogen until required. HGSOC patients were determined from pathology records and were included in the study where there was matched tumour and whole blood samples. Tumour samples were divided into two for DNA and RNA extraction and slivers of tissue were taken, fixed in formalin and embedded in paraffin wax (FFPE). Samples were only included if they were confirmed as HGSOC and there was greater than 40% tumour cellularity throughout the tumour, determined using H&sE staining of the FFPE sections and pathology review. Somatic DNA was extracted from the tumour and germline DNA was extracted from whole blood. Somatic DNA was extracted using the Qiagen DNeasy Blood and tissue kit (cat no 69504). The tissue was initially homogenised using a Qiagen Bioruptor, followed by the manufacturers recommended protocol (including RNase digestion step). Germline DNA was extracted from 1-3ml whole blood using the Qiagen FlexiGene kit (cat no 51206) following the manufacturers recommended protocol. The resulting DNA underwent quality control as follows: firstly, A260 and A280nm were measured on a Denovix DS-11 Fx to qualitatively illustrate A260/280nm and A260/230nm ratios as surrogate measures of DNA purity. A260/280 had to be 1.8 or greater and A260/230 had to be 2.0 or greater. Then, DNA was quantified using LifeTechnologies Qubit dsDNA BR kit (cat no Q32850) and we required a minimum of 50ul at 25ng/ul for WGS. Thirdly, DNA was diluted to 25ng/ul and a representative sample was loaded onto a 0.8% TAE gel, ran at 100v for 60mins and then imaged using a BioRad ChemiDoc imaging system to visualise the DNA quality.

  Dataset EGAD00001010135

• WGS of high grade serous ovarian tumours and matched blood normals

  FASTQ reads for 81 matched tumour-normal WGS pairs for high grade serous ovarian cancer patients. Scottish HGSOC samples were collected via local Bioresource facilities at Edinburgh, Glasgow, Dundee and Aberdeen and stored in liquid Nitrogen until required. HGSOC patients were determined from pathology records and were included in the study where there was matched tumour and whole blood samples. Tumour samples were divided into two for DNA and RNA extraction and slivers of tissue were taken, fixed in formalin and embedded in paraffin wax (FFPE). Samples were only included if they were confirmed as HGSOC and there was greater than 40% tumour cellularity throughout the tumour, determined using H&E staining of the FFPE sections and pathology review. Somatic DNA was extracted from the tumour and germline DNA was extracted from whole blood. Somatic DNA was extracted using the Qiagen DNeasy Blood and tissue kit (cat no 69504). The tissue was initially homogenised using a Qiagen Bioruptor, followed by the manufacturers recommended protocol (including RNase digestion step). Germline DNA was extracted from 1-3ml whole blood using the Qiagen FlexiGene kit (cat no 51206) following the manufacturers recommended protocol. The resulting DNA underwent quality control as follows: firstly, A260 and A280nm were measured on a Denovix DS-11 Fx to qualitatively illustrate A260/280nm and A260/230nm ratios as surrogate measures of DNA purity. A260/280 had to be 1.8 or greater and A260/230 had to be 2.0 or greater. Then, DNA was quantified using LifeTechnologies Qubit dsDNA BR kit (cat no Q32850) and we required a minimum of 50ul at 25ng/ul for WGS. Thirdly, DNA was diluted to 25ng/ul and a representative sample was loaded onto a 0.8% TAE gel, ran at 100v for 60mins and then imaged using a BioRad ChemiDoc imaging system to visualise the DNA quality.

  Dataset EGAD00001009049

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• GEI Studies - Psoriasis

  The GEI Studies Project was started as an NIH consortium involving 5 disease groups with funding provided through the Genes, Environment, and Health Initiative (GEI). The objective of the project was to optimize strategies for identifying rare variants as a follow up to genome-wide association studies (GWAS) using next-generation sequencing technology. One of the five targeted diseases, Psoriasis, is a multifactorial skin disease characterized by epidermal hyperproliferation and chronic inflammation that affects approximately 2% of Americans. Because only about one-third of all patients with psoriasis have a relative who is also affected with the disorder, psoriasis is not widely recognized as a genetic disease. However, previous research on families and identical twins has shown psoriasis has a strong genetic component, although environmental factors (such as infections, stress, and injuries) are also important. Although no definite psoriasis gene has yet been identified, research during the last ten years has revealed over forty potential gene locations that may contribute to the disease. Large amounts of data generated using next-generation sequencing technology would provide a more detailed characterization of sequence variation which would in turn increase the likelihood of detecting causative loci. With the presumption that rare variants are frequently the cause of a large portion of phenotypic variation, it was necessary to use large sample sets. In the main body of this study, we sequenced 4,966 samples (812 dermatologist-diagnosed cases of purely cutaneous psoriasis (PsC), 1,497 cases of rheumatologist-diagnosed psoriatic arthritis, 665 cases of cutaneous psoriasis with uncertain psoriatic arthritis status (PsV) and 1,992 controls) across 5.7 Mb of sequence containing 100 psoriasis candidate loci and 769 genes. For each candidate locus, we considered sequences within 250 kb of the strongest association signal. Within this window, three strategies were employed. For ten of the strongest psoriasis signals, we used a whole-region approach which included non-coding intergenic and intronic sequence. For four established loci of lesser significance, we targeted all full transcription units within the +/- 250 kb interval. For the remaining signals, we targeted the exons of all transcription units within the +/- 250 kb interval. Due to complexities of high-efficiency targeting of HLA genes we selected 5 specific candidate genes for sequencing near the HLA-C gene.

  Study phs000766

• Rapid Acceleration of Diagnostics - Digital Health Technologies' (RADx-DHT) Collection of General Research Use Datasets

  This individual-level collection of datasets contains all the RADx Digital Health Technologies (RADx-DHT) studies in dbGaP for General Research Use (GRU). Access to studies in this collection is on the RAPIDS platform. To request access to this study collection, select phs003666 in the dbGaP when submitting a data access request.

  Study phs003666

• APCIM_Nanostring_FAP

  Expression of immune related genes in 12 familial adenomatous polyposis patients. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002553

• Single Nuclei RNA sequencing batch 2

  This dataset includes the 2 extra normal samples adjacent to PTC tumors that were multiplexed and profiled using kits from different batches.

  Dataset EGAD00001011364

• RNASeq profiles from Indian HFrEF Cohort

  The dataset contains whole transcriptomics profiling from a cohort of 49 HFrEF patients. The myocardium samples were collected from these patients during heart transplant of LVAD implantation procedure. The RNA samples were collected in RNAlater. Total transcriptome libraries were prepared using TruSeq Stranded Total RNA Library Prep with Ribo-Zero Gold kit and sequenced on Illumina HiSeq4000.

  Dataset EGAD50000001196

• Expression Quantitative Trait Locus Mapping Studies in Mid-Secretory Phase Endometrial Cells Identifies HLA-F and TAP2 as Fecundability-Associated Genes

  We performed an unbiased genome-wide expression quantitative trait locus (eQTL) mapping study to identify common regulatory (expression) single nucleotide polymorphisms (eSNPs) in mid-secretory endometrium, corresponding to the luteal phase of the ovarian cycle. Biopsies were collected from 58 women with two or more early pregnancy losses and 53 of these samples passed all quality control. RNA was extracted from endometrial biopsies and DNA was extracted for sequencing from blood. Gene expression data can be found at NCBI GEO Series GSE77688.

  Study phs001146

• TRACERx100 metastatic samples

  Whole exome sequencing of 10 metastatic biopsies from four TRACERx100 patients (see EGA dataset EGAS00001002247), collected either after relapse or death. The data from these samples are initially published with Abbosh, C. et al. Phylogenetic ctDNA analysis depicts early stage lung cancer evolution. Nature, http://dx.doi.org/10.1038/nature22364 (2017). Abstract: Earlier detection of relapse following primary surgery for non-small cell lung cancer and the characterization of emerging subclones seeding metastatic sites might offer new therapeutic approaches to limit tumor recurrence. The potential to non-invasively track tumor evolutionary dynamics in ctDNA of early-stage lung cancer is not established. Here we conduct a patient-specific approach to ctDNA profiling in the first 100 lung TRACERx (TRAcking Cancer Evolution through therapy (Rx)) study participants, including one patient co-recruited to the PEACE (Posthumous Evaluation of Advanced Cancer Environment) post-mortem study. We identify independent predictors of ctDNA release in early-stage non-small cell lung cancer and perform tumor volume limit of detection analyses. Through blinded profiling of post-operative plasma, we observe evidence of adjuvant chemotherapy resistance and identify patients destined to experience recurrence of their lung cancer. Finally, we show that phylogenetic ctDNA profiling tracks the subclonal nature of lung cancer relapse and metastases, providing a new approach for ctDNA driven therapeutic studies.

  Dataset EGAD00001003301

• TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells.

  We examined tumours from a large cohort of patients with metastatic urothelial bladder cancer (mUC) treated with an anti–PD-L1 agent (atezolizumab) and identified major determinants of clinical response and immune escape. Whole transcriptome profiles were generated for 368 patients using TruSeq RNA Access technology (Illumina). Somatic mutations were determined via whole exome sequencing for a subset of these patients. - Response was associated with CD8+ T effector cell phenotype and, to an even greater extent, high neoantigen or tumour mutation burden (TMB). On the other hand, lack of response was associated with a transforming growth factor β (TGF-β) signature, particularly in patients with CD8+ T cells preferentially residing in collagen-rich matrix surrounding tumours. Integration of these three independent biological features provided the best basis for understanding outcome in this setting. -

  Study EGAS00001002556

• Profiling of 27 type 2 diabetes GWAS loci using next-generation (NG) capture C in a human beta-cell model

  Most type 2 diabetes association signals are due to variants that impact gene regulation but identifying the genes they impact is challenging. We generated interaction profiles at 27 T2D GWAS loci using next-generation (NG) capture C (6 replicates) in the human beta-cell model, EndoC-betaH1, along with chromatin accessibility profiling using ATAC-Seq (9 replicates).

  Dataset EGAD00001008655

• A benchmark of DNA methylation deconvolution methods for tumoral fraction estimation using DecoNFlow

  In cancer patients, circulating cell-free DNA (cfDNA) originates from both healthy and cancer cells, and the proportion of tumor-derived cfDNA serves as a surrogate marker of tumor burden. Tumoral cfDNA can be identified using patient-specific mutations or more general tumor-specific DNA methylation patterns that are preserved in cfDNA, enabling non-invasive cancer detection and monitoring. Accurately estimating tumor fractions remains challenging due to the heterogeneous mixture of cfDNA sources in body fluids. Computational DNA methylation deconvolution methods can address this by estimating tumoral fraction with or without reference methylomes. Here, we benchmarked 10 reference-based and 2 reference-free DNAm deconvolution tools and provide the data generated for this benchmarking, consisting of 10 neuroblastoma cell lines and one healthy cfDNA sample (pooled from 15 healthy cfDNA samples), profiled using cfRRBS.

  Study EGAS50000001529

• Breast Cancer Family Registry

  The Breast Cancer Family Registry (BCFR) is a multi-center prospective cohort, comprised of over 30,000 women and men from nearly 12,000 families from the United States, Canada, and Australia. Our BCFR resource has been used, and continues to be used, by breast cancer researchers around the world in order to find new ways to prevent, diagnose, and treat cancer. The BCFR provides an extensive and diverse range of resources, expertise, and specialized skills, and has several unique strengths: 1) the collection of a large number of individuals and families across a wide spectrum of breast cancer risk, including both affected and unaffected individuals; 2) the large collection of families with early-onset breast cancer; 3) the large collection of racial/ethnic minority families not replicated elsewhere; 4) the extensive molecular characterization performed to date; and 5) active follow-up of both probands and family members. Thus, the BCFR comprises a unique cohort of probands and family members at familial/genetic risk of breast cancer that will continue to facilitate a wide range of research studies, such as gene discovery, examination of cancer-related outcomes and risk factors in high-risk subjects, investigation of novel behavioral interventions, and cancer prevention trials among at-risk family members. Consequently, the BCFR Cohort, as one of the few cohorts available worldwide with biospecimens and extensive molecular and genetic characterization, combined with epidemiologic data and long-term follow up, will be an invaluable resource for translational research in the genetic epidemiology of breast cancer.

  Study phs002835