14983 results for "cancer studies using rna-seq"

in 16.48 milliseconds.

• Identifying aberrant splicing isoforms and potential neoantigens in non-small cell lung cancer

  To identify aberrant splicing isoforms and potential neoantigens, we performed full-length cDNA sequencing of seven non-small cell lung cancer specimens using a long-read sequencer MinION. We detected aberrant splicing isoforms using our bioinformatics pipeline and constructed a comprehensive catalogue.

  Study JGAS000245

• Targeted Sequencing of Primary ER-positive Breast Tumors Treated with 5 Years of Tamoxifen

  Targeted massively parallel sequencing analysis was conducted on DNA extracted from archived 22-28 year old, formalin-fixed primary breast tumors from 625 patents from British Columbia treated with five years of adjuvant tamoxifen monotherapy and followed for over 10 years. Genes were selected for targeted sequencing by review of existing large-scale breast cancer sequencing studies and breast cancer literature. In total, 83 genes were identified and 3,029 probes were designed to tile across all known exons. Illumina sequencing libraries were constructed, indexed, pooled, and enriched for target sequences by hybrid-capture followed by sequencing of paired-end 100bp reads. All samples met minimum quality controls of 80% targeted space covered at 20X or greater. On average, each sample had 336M aligned bases and a mean coverage of 135.8X.

  Study phs001234

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• fibroblast transcriptome of pediatric patients with epilepsy

  RNA sequencing of fibroblasts from pediatric patients with childhood epilepsy. Fibroblast RNA was extracted at passage 3-6 using MN nucleospin, >90M 150bp paired-end reads per sample were obtained with illumina sequencing. Reads were aligned to hg38.

  Dataset EGAD50000001166

• snRNA and snATAC analysis of cocaine use disorder in human caudate nucleus

  We investigated cell type specific changes of gene expression and chromatin accessibility in the caudate nucleus of N=6 individuals with and N=8 individuals without cocaine use disorder using postmortem human brain samples. We performed single-nuclei RNA-sequencing and single-nuclei ATAC sequencing in the same cells using the 10xMultiome platform. The N=14 tissue donors were of African-American ancestry. The cohort consists of N=5 female and N=9 male individuals.

  Study EGAS50000000480

• Shallow whole genome sequencing of ctDNA samples from DETECT study

  A large-scale retrospective study in metastatic breast cancer patients using circulating tumour DNA and machine learning to predict treatment outcome and progression-free survival from the paper "A large-scale retrospective study in metastatic breast cancer patients using circulating tumour DNA and machine learning to predict treatment outcome and progression-free survival", by Beddowes et al. Mol.Onc.

  Study EGAS50000000911

• Mapping genetic effects on cell type-specific chromatin accessibility using single nucleus ATAC-seq

  Gene regulation is highly cell type-specific and understanding the function of non-coding genetic variants associated with complex traits requires molecular phenotyping at cell type resolution. In this study we performed single nucleus ATAC-seq (snATAC-seq) and genotyping in peripheral blood mononuclear cells from 13 individuals. We mapped chromatin accessibility QTLs (caQTLs) in each immune cell type and sub-type in a subset of 10 samples of European genetic ancestry.

  Study EGAS00001006184

• Chromatin run-on and RNA sequencing of fibrolamellar carcinoma

  Fibrolamellar carcinoma (FLC) is a rare, therapeutically intractable liver cancer that disproportionately affects youth. Here we used chromatin run-on sequencing to characterize the enhancer landscape in FLC and RNA sequencing to identify dysregulated genes in FLC.

  Study EGAS00001004169

• Nivolumab plus chemotherapy or ipilimumab in gastroesophageal cancer: CheckMate 649 biomarker analyses

  First-line nivolumab-plus-chemotherapy demonstrated superior overall survival (OS) versus chemotherapy for advanced gastroesophageal adenocarcinoma (CheckMate 649). Nivolumab-plus-ipilimumab provided durable responses and higher survival rates versus chemotherapy; however, the prespecified OS significance boundary was not met. To identify biomarkers predictive of differential efficacy outcomes, exploratory analyses were performed using whole-exome sequencing and RNA sequencing. Nivolumab-based therapies demonstrated improved efficacy versus chemotherapy in hypermutated and, to a lesser degree, Epstein Bar Virus-positive tumors compared with chromosomally unstable and genomically stable tumors. Within the KRAS-altered subgroup, only patients treated with nivolumab-plus-chemotherapy demonstrated improved OS benefit versus chemotherapy. Low stroma gene expression signature scores were associated with OS benefit with nivolumab-based regimens; high regulatory T-cell signatures were associated with OS benefit only with nivolumab-plus-ipilimumab. Our analyses suggest that distinct and overlapping pathways contribute to the efficacy of nivolumab-based regimens in gastroesophageal adenocarcinoma.

  Study EGAS50000000747

• RNA-seq consisting of FASTQ paired-end reads from cancer samples

  Efforts to precisely identify tumor human leukocyte antigen presented peptides (HLAp) capable of mediating T cell based tumor rejection still face important challenges. Recent reports suggest that non-canonical cancer HLAp could be immunogenic but their identification requires highly sensitive and accurate mass-spectrometry (MS)-based proteogenomics approaches. Here, we present a MS-based analytical pipeline that can precisely characterize the non-canonical HLAp repertoire, incorporating whole exome sequencing, bulk and single cell transcriptomics, ribosome profiling, and a combination of two MS/MS search tools. This approach results in the accurate identification of hundreds of shared and tumor-specific non-canonical HLAp. Albeit often at low levels and in distinct subpopulations of cells, numerous non-canonical HLAp are shared across tumors. This analytical platform holds great promise for the discovery of novel cancer antigens for cancer immunotherapy.

  Study EGAS00001003724

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562