15020 results for "cancer studies using rna-seq"

in 13.92 milliseconds.

• Paraganglioma Smart-Seq2 Single Nuclei Sequencing Data

  Paraganglioma is a rare neuroendocrine tumor that originates from chromaffin cells of the adrenal medulla or extra-adrenal paraganglia. This study aims to investigate the heterogeneity of this tumor and to identify potential biomarkers associated with its malignancy. To achieve this, we performed single-nucleus RNA sequencing of human paraganglioma samples using the SMART-Seq2 protocol.

  Study EGAS50000001184

• Pediatric Investigation for Genetic Factors Linked with Renal Progression (PediGFR)

  The Pediatric Investigation for Genetic Factors Associated with Renal Progression (PediGFR) (RO1-DK082394) is an international collaborative study among three large prospective cohort studies of children with chronic kidney disease. The participating parent cohort studies are the Chronic Kidney Disease in Children (CKiD), the Effect of Strict Blood Pressure Control and ACE Inhibition on CRF Progression in Pediatric Patients (ESCAPE), and the Cardiovascular Comorbidity in Children with Chronic Kidney Disease (4C) study. In these cohorts, pediatric subjects with CKD have been prospectively followed with standardized measurements for renal progression. The dbGaP data upload will utilize the structure of sub-studies to include the genotype and baseline phenotype for the three cohorts, as well as the RBC trait and anemia data for a sub-study under PI Susan Furth: Role of Genetic Variation in the Anemia of Chronic Kidney Disease (K24DK078737). In brief PediGFR is a prospective study of children with chronic kidney disease (CKD) to determine genetic factors associated with kidney function measured by the estimated glomerular filtration rate (eGFR) by Schwartz equation. The PediGFR_v2 Cohort is utilized in the following dbGaP sub-studies. To view genotypes, other molecular data, and derived variables collected in these sub-studies, please click on the following sub-studies below or in the "Sub-studies" box located on the right hand side of this top-level study page phs000842 PediGFR_v2 Cohort. phs000843 4C phs000650 CKiD phs000844 ESCAPE

  Study phs000842

• Dataset of 5 RNAseq from 3 non-muscle-invasive bladder cancer patients

  RNAseq (FASTQ files) of 5 tumor from 3 non-muscle-invasive bladder cancer patients. For patient UC2, RNA from 3 different synchronous tumors was extracted. Relating to the other datasets from the project : no RNA was available from patient UC4. NB : patients aliases are the following : ROXY : UC1, OMAD : UC2, MAKI : UC3, HAPE : UC4

  Dataset EGAD50000002009

• Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Dataset EGAD00001015397

• Human lymphoma plasma cfRNA - raw data

  This study contains total RNA sequencing data from plasma of 65 different human donors: 30 diffuse large B-cell lymphoma patients, 13 primary mediastinal large B-cell lymphoma patients and 22 cancer-free controls.

  Study EGAS00001007127

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326