11996 results for "division 2 coins fc 26 Visit Buyfc26coins.com Kupiłem(a) duży pakiet monet FC 26 i dostałem(a) dodatkowy rabat. Świetnie!.fXzt"

in 17.07 milliseconds.

• IYDP Indonesian Y chromosome Diversity Project

  Island Southeast Asia and Oceania host one of the world’s richest assemblages of human phenotypic, linguistic and cultural diversity. We compiled ~9.7 Mb of Y chromosome sequence from a diverse sample of over 380 men from this region, including 126 from Indonesian islands, first reported here. The granularity of this dataset allows us to fully resolve and date the regional Y chromosome phylogeny. This improved Y chromosome topology highlights localized events with important historical implications, including pre-Holocene contact between Mainland and Island Southeast Asia, ongoing interactions between Australia and the Papuan world, and a sustained period of diversification following the flooding of the ancient Sunda and Sahul continents as the insular landscape of today formed. The high-resolution phylogeny of the Y chromosome presented here thus enables a detailed exploration of past isolation, interaction and change in one of the world’s least understood regions.

  Study EGAS00001006028

• Spatial atlas of clonal copy number alterations in co-existing benign and malignant tissue

  Defining the transition from benign to malignant tissue is fundamental to improve early diagnosis of cancer. Here, we use a systematic approach to study spatial genome integrity in situ and describe previously unidentified clonal relationships. We employed spatially resolved transcriptomics to infer spatial copy number variations in >120,000 regions across multiple organs, in benign and malignant tissues. We demonstrate that genome-wide copy number variation reveals distinct clonal patterns within tumours and in nearby benign tissue using an organ-wide approach focused on the prostate. Our results suggest a model for how genomic instability arises in histologically benign tissue that may represent early events in cancer evolution. We highlight the power of capturing the molecular and spatial continuums in a tissue context and challenge the rationale for treatment paradigms, including focal therapy.

  Study EGAS00001006124

• Targeting AXL Kinase Uniquely Sensitizes Therapy-Insensitive Leukemic Stem and Progenitor Cells to Venetoclax Treatment in Acute Myeloid Leukemia

  The abundance of genetic abnormalities and phenotypic heterogeneities in AML pose significant challenges to developing improved treatments. Here we demonstrated that a key GAS6/AXL axis is highly activated in AML patient cells, particularly in leukemic stem cells. We developed a potent, selective AXL inhibitor that has excellent pharmaceutical properties and efficacy against preclinical patient-derived xenotransplantation models of AML. Importantly, inhibition of AXL sensitized AML stem/progenitor cells to venetoclax treatment, with strong synergistic effects in vitro and in vivo. Mechanistically, single-cell RNA-sequencing and functional validation studies uncovered that AXL inhibition or in combination with venetoclax potentially targets intrinsic metabolic vulnerabilities of AML stem/progenitor cells, which shows a distinct transcriptomic profile and inhibits mitochondrial oxidative phosphorylation. These findings have direct translational impact on the treatment of AML and other cancers with high AXL activity.

  Study EGAS00001004663

• Genomic_profiling_of_B_other_Adult_ALL_RNA

  Adult ALL is an aggressive leukaemia, affecting adults of all ages. It is associated with a rapid onset and poor outcomes. Our understanding of adult ALL genome has been limited to molecular markers first described in paediatric ALL and validated in adult ALL and to date there have been no studies investigating the genomics of Adult ALL. We will perform whole genome sequencing on at least 100 Adult ALL cases. Priority will be given on ALL cases without a known primary lesion by cytogenetic analysis which are categorised as “B-other”. We will also sequence representative cases of each known subtype. This will deliver a comprehensive annotation of the genomic landscape of Adult ALL to include acquired somatic mutations (substitutions, indels, structural variants/fusion genes) and copy number profiles. The focus on B-other Adult ALL is likely to result in new and previously undescribed genomic lesions.

  Study EGAS00001003428

• Application of high-throughput, high-depth, targeted single-nucleus DNA sequencing in pancreatic cancer

  Despite insights gained by bulk DNA sequencing of cancer it remains challenging to resolve the admixture of normal and tumor cells, and/or of distinct tumor subclones; high throughput single-cell DNA sequencing circumvents these and brings cancer genomic studies to higher resolution. However, its application has been limited to liquid tumors or a small batch of solid tumors, mainly because of the lack of a scalable workflow to process solid tumor samples. Here we optimized a highly automated nuclei extraction workflow that achieved fast and reliable targeted single-nucleus DNA library preparation of 38 samples from 16 pancreatic ductal adenocarcinoma (PDAC) patients, with an average library yield per sample of 2867 single nuclei. We demonstrate that this workflow not only performs well using low cellularity or low tumor purity samples but reveals novel genomic evolution patterns of PDAC as well.

  Study EGAS00001006024

• single-stranded DNA study

  A ssDNA library protocol was applied to cfDNA from plasma samples obtained from different DNA extraction methods and revealed significant differences in DNA fragmentation patterns in comparison to dsDNA-based protocols. In particular, a specific combination of methods revealed a population of ultrashort fragments, organized at ~50 bp. We observed significant differences in the relative abundance of these ultrashort DNA fragments in plasma from healthy individuals and cancer patients. Through shallow whole genome sequencing (sWGS, <0.5-fold coverage) and the analysis of somatic copy number aberrations (SCNA), we determined the landscape of genetic alterations in this newly identified population of cfDNA fragments. In addition, we studied their potential link with regulatory regions by investigating the genome-wide coverage patterns at transcription start sites (TSS). Furthermore, we demonstrated that the ultrashort cfDNA fragments map to regions associated with secondary DNA structures, G-quadruplexes (G4s).

  Study EGAS00001005093

• The impact of mutational clonality in predicting the response to anti-PD-L1/PD-L1 in advanced urothelial cancer

  The advent of immune checkpoint inhibitors (ICI) has radically changed the management and therapeutic treatment landscape for patients with cancer. It has been shown that the use of these inhibitors can result in long-term complete remissions even in cases with advanced stages of the disease. However, only a small fraction of patients respond to the treatment. A better understanding of which factors could drive this clinical benefit is fundamental to building more accurate predictive biomarkers and developing alternative therapeutic options for patients who are unlikely to benefit. In order to address this issue, we have generated and analyzed whole exome sequencing (WES) and RNA sequencing (RNASeq) data from a cohort of metastatic urothelial carcinoma patients (N = 27) treated with ICI such as anti-PD-(L)1 monoclonal antibodies.

  Study EGAS00001007086

• Genome-wide cell-free DNA biological patterns in patients with cancer

  The structure of cell-free DNA (cfDNA) is altered in the blood of cancer patients. From whole genome sequencing we retrieved the cfDNA fragment-end composition using a new software (FrEIA), as well as the cfDNA size and tumor fraction in three independent cohorts (n=925 cancer from >10 types and 321 control samples). At 95% specificity, we detect 72% of cancer samples using at least one cfDNA measure, including 64% of early-stage cancer (n=220). cfDNA detection correlates with a shorter overall (p=0.018) and recurrence-free (p=0.006) survival in patients with resectable esophageal adenocarcinoma. Integrating cfDNA measures with machine learning in an independent test set (n=396 cancer, 90 controls) achieve a detection accuracy of 82% and AUROC of 96%. In conclusion, harnessing the biological features of cfDNA can improve at no-extra cost the diagnostic performance of liquid biopsies.

  Study EGAS00001007400

• Cancer of Low survival and UnMet Need – Pathologist Initiated

  Despite significant advances in diagnostic cancer histopathology, a subset of tumors remain unable to be classified using WHO criteria. The resulting diagnostic uncertainty can result in inappropriate clinical management and negative patient outcomes. We investigated whether combining histopathology with whole genome and transcriptome sequencing (WGTS) could improve the classification of tumors that posed diagnostic dilemmas despite extensive histopathology and standard molecular work-up at a quaternary oncology center. We successfully sequenced 45 tumors from an initial set of 54 unclassified tumors (83% success rate). A confident diagnosis was made for 38/45 tumors (84%). Additionally, potential treatment targets were identified in 21/45 tumors (47%). Theoretical comparison with alternative assays demonstrated that WGTS was uniquely capable of detecting critical diagnostic findings in 15/38 tumors (39%). This work supports augmenting histopathology and standard molecular pathology with WGTS in the classification of difficult-to-diagnose tumors.

  Study EGAS00001008112

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131