21163 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..6Xgd"

in 35.69 milliseconds.

• Data Access Committee for German Consortium for Translational Cancer Research (DKTK)

  Dac EGAC00001000217

• Data Access Committee for COLO829 Somatic reference standard for cancer genome sequencing

  Dac EGAC00001000408

• ATACseq

  ATACseq data for this study.

  Study EGAS00001007166

• SNParray

  SNP array study for UTUC

  Study EGAS00001004979

• Sequencing data for oesophageal and related samples - OACs release 4 (RNA)

  Dataset EGAD00001004021

• Leukemia WGS data

  Whole-genome sequencing data from 38 leukemia patients and 12 leukemia cell lines; Containing 100 fastq files; Two files for each sample.

  Dataset EGAD00001008659

• cfDNA dataset for cfDNA cohort

  Cell free DNA sequencing data for 233 samples across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000104

• Targeted sequencing analysis for MDS with HSCT

  Targeted capture sequencing for cases with MDS who were subjected to unrelated bone marrow transplantation via Japan marrow donor program

  Study EGAS00001001949

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Acute Myeloid Leukemia peripheral blood ATAC data

  ATAC-seq was used to profile the accessible chromatin landscape of 29 (12 LSC17 high, 17 LSC17 low) peripheral blood AML bulk samples. 50,000 cells from each sample were processed and libraries were sequenced with 50 bp paired-end reads.

  Dataset EGAD00001006776

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Paired whole genome sequencing of tumor-control pairs of Thymic epithelial tumors

  Paired whole genome sequencing of tumor-control pairs of Thymic epithelial tumors, 25 samples with paired fastq files, sequenced on Illumina-HiSeq_X_Ten and using the Illumina_TruSeq_Nano_DNA kit.

  Dataset EGAD00001009094

• whole exome sequencing of 8 tumor-control pairs of Thymic epithelial tumors

  Paired whole exome sequencing of 8 tumor-control pairs of Thymic epithelial tumors, sequenced on Illumina HiSeq 4000 and using the Agilent SureSelect V5+UTRs Kit.

  Dataset EGAD00001009095

• monozygotic twin discordant for schizophrenia

  monozygotic twin discordant for schizophrenia

  Dataset EGAD00001000048