21043 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..JIZq"

in 29.60 milliseconds.

• Whole Genome Sequencing of Head and Neck Angiosarcoma

  This dataset contains 55 Whole Genome Sequencing of the study titled Spatial transcriptomics reveal topological immune landscapes of Asian head and neck angiosarcoma.

  Dataset EGAD00001010140

• Prostate cancer m6A epitranscriptome

  Using meRIP-sequencing, we profiled N-6 methyladenosine (m6A) in a cohort of 148 primary prostate cancer samples as part of the Canadian Prostate Cancer Genome Network project (CPC-GENE). Paired-end sequencing of 150 bp reads were mapped to GRCh38.p13 using annotations from gencode.v34.chr_patch_hapl_scaff.annotation.gtf. Peaks were called using MeTPeak, joint peaks were identified and IP reads were quantitated, normalized and adjusted using Input reads to obtain estimates of m6A abundance.

  Dataset EGAD00001009869

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010315

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010318

• ATAC-seq and RNA-seq datasets of CD14+ monocytes from healthy donors

  This dataset consists of functional genomic data from 6 healthy donors taken from CD14+ monocytes upon different immune stimulations. It contains 150 paired end fastq files consisting of 30 total RNA-seq samples across 4 runs and 30 ATAC-seq samples. The samples were sequenced on Illumina HiSeq4000 platform.

  Dataset EGAD00001011113

• Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient

  Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient,generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001015583

• Single-cell analysis of matched FFPE and frozen tissue samples reveals comparable resolution of intratumoural heterogeneity

  Testing the differences between FFPE and fresh frozen derived single cell results.

  Dataset EGAD00001015781

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• The effects of bioinformatics preprocessing on cell-free DNA analysis

  The dataset contain 20 lung cancer and 20 healthy control cfDNA samples from plasma sequenced using 150bp PE sequencing.

  Dataset EGAD50000000213

• Childhood cerebellar tumors mirror conserved fetal transcriptional programs

  We used single-cell transcriptomics to study >60,000 cells from the developing murine cerebellum, and show that different molecular subgroups of childhood cerebellar tumors mirror the transcription of cells from distinct, temporally restricted cerebellar lineages.

  Dataset EGAD00001004318

• A compendium of mutational signatures due to environmental exposures

  Analysis of mutational signatures caused by exposure to known mutagens in human induced pluripotent stem (iPS) cells. A reference human iPS cell-line will be exposed to 100 chemicals known or proposed to be mutagenic. Following exposure to mutagen, cells will undergo a period of recovery before sub clones are generated and sequenced. The progenitor "parental" IPS cell-line will be used to generate reference sequence data, in order to determine the mutational signatures acquired as a result of exposure to different mutagens.

  Dataset EGAD00001005351

• RNA-seq data from primary AML samples with t(3;8)

  RNA-seq was generated to investigate differences in gene expression between t(3;8) AML and other primary AMLs. Briefly, sample libraries were prepared using 500 ng of input RNA according to the KAPA RNA HyperPrep Kit with RiboErase (HMR) (Roche) using Unique Dual Index adapters (Integrated DNA Technologies, Inc.). Amplified sample libraries were paired-end sequenced (2x100 bp) on the Novaseq 6000 platform (Illumina

  Dataset EGAD00001006819

• VRK3 depletion in Pontine Diffuse Midline Glioma DMG-K27 altered cells

  In order to investigate possible mechanisms underlying the phenotype of cell fitness decline observed following decrease of VRK3 in pontine DMG-K27 altered cells 7, we examined differences in global gene expression. RNA-seq was performed 44h and 60h post-transduction with two distinct shRNAs targeting VRK3 to be able to evaluate the early impact of VRK3 knock-down (KD) in four independent in vitro models of DMG

  Dataset EGAD00001010097

• Very short reads file for testing purposes

  Very short FASTQ reads file for testing purposes

  Study EGAS00001001701

• The Dutch Microbiome Project Batch 1

  The Dutch Microbiome Project (DMP) data includes shotgun metagenomic sequencing of faecal samples 8,208 Dutch individuals. Paired-end sequencing was performed using Illumina HiSeq 2000 platform. Data is archived in two batches to facilitate easier data access and upload to EGA. Batch 1 of DMP includes 4396 samples.

  Dataset EGAD00001007027

• Neo-CheckRay

  Patients with oestrogen receptor-positive (ER+), HER2-negative, early breast cancer (BC) have low pathological complete response (pCR) rates following neoadjuvant chemotherapy (NACT). Phase 3 trials showed that adding an anti-PD-1 immune checkpoint inhibitor (ICI) improves pCR, but there was less benefit in the PD-L1 negative tumours, characterised by an immune “cold” tumour microenvironment (TME). We hypothesized that immune-modulating stereotactic body radiation therapy (iSBRT) could enhance treatment response by reprogramming the immune deprived TME in early ER+/HER2- BCA. We conducted a phase 2, randomized, multicentre trial evaluating NACT plus iSBRT, with or without durvalumab (anti-PD-L1) and with or without oleclumab (anti-CD73) in 147 patients with high-risk, early, ER+/HER2- breast cancer patients.

  Study EGAS50000001777

• Intellectual Disability cases with parents (trios) or affected sibs (sibpairs)

  Samples from ID cases negative for CNV through array-CGH were submitted to exome sequencing. Families with one affected individual underwent trio exome sequencing for identification of de novo variants. Families with more than one affected child underwent sibpair sequencing for identificatio of shared recessive or x-linked variants.

  Study EGAS00001003968

• Dataset for urologic_cancer-EXON

  Rare cancer sequencing data of 112 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008904

• Distinct embryonic phylogenies and driver events of infant Wilms tumor - RNA

  Cancers of adults typically arise through progressive rounds of clonal diversification and intratumoral selective sweeps which generate a long mutational trunk with shorter subclonal branches. Here, we investigated whether tumors of young children exhibit the same phylogenetic configuration. We studied three infants, including two newborns, with the childhood kidney cancer, Wilms tumour, through whole genome sequencing of bulk tissues, of single cell derived organoids, and of microdissections. All three cancers exhibited unusual driver events, with tumours of newborns harbouring FOXR2 rearrangements, delineating a distinct variant of Wilms tumour. Phylogenetic analyses suggest that tumors were seeded in an early, possibly confined window of development. Unusually, following seeding there was extensive polyclonal diversification with little evidence of clonal sweeps, leading to a distinct phylogenetic configuration more reminiscent of normal tissues rather than of adult cancers. These findings indicate that some childhood cancers may diversify via unorthodox phylogenetic pathways.

  Dataset EGAD00001009813

• High-resolution analysis for urinary DNA jagged ends

  High-resolution analysis for urinary DNA jagged ends

  Study EGAS00001005603

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236