17329 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 26.18 milliseconds.

• SNP data for Breast cancer PRS

  SNP data for 313 loci required for calculation of the Breast cancer PRS

  Dataset EGAD00001008144

• ATAC-Seq on OCIAML-22 Fractions

  The donor AML patient (unsorted) that was used to generate OCI-AML22 was expanded for 3-4 months, then sorted for the indicated fraction (CD34p: CD34+; CD34m: CD34-)

  Study EGAS00001006511

• The dataset for "Validation of cfDNA fragmentome analyses for early detection of liver cancer"

  The dataset for “Validation of cfDNA fragmentome analyses for early detection of liver cancer” includes 380 cram files from whole genome next-generation sequencing on the Illumina NovaSeq 6000 with 10x coverage. The samples analyzed include plasma samples from patients with cancer and liver disease.

  Dataset EGAD00001015538

• Study of Adaptation to Hypoxia in Ethiopian Highlanders via Whole Genome Sequencing

  Although it has long been proposed that genetic factors contribute to adaptation to high altitude, such factors remain largely unverified. Recent advances in high-throughput sequencing have made it feasible to analyze genome-wide patterns of genetic variation in human populations. Since traditionally such studies surveyed only a small fraction of the genome (either exons or a subset of SNPs) or a group of candidate genes, interpretation of the results was limited. We focused our study on Ethiopian highlander populations, which have been found to be well adapted to high altitudes (~3500m). We sequenced and analyze the genomes of 13 high altitude native Ethiopians: 6 individuals of Oromo heritage living on Bale Plateau (labeled "Oromos"), and 7 individuals residing on the Chennek field in the Simien Mountains (labeled "Amhara"). Our study revealed evolutionarily conserved genes that modulate hypoxia tolerance.

  Study phs000647

• PanProstate Cancer Group DK data

  THE PAN PROSTATE CANCER PROJECT: Many groups around the world have generated Whole Genome DNA Sequence (WGS) data from prostate cancer patients. The pan prostate group have gathered with the idea that the accumulated data, should be collected and compared in a common format including common storage, re-analysis through a single pipeline, and investigation to achieve a variety of scientific goals. The combined collection would include the following categories: (i) cancers from different ethnic groups: eg Caucasian, Asian, Black Caribbean; (ii) cancer from different stages of progression from normal, to organ-confined disease, to metastases; (iii) early-onset prostate cancer; (iv) prostate cancer from aggressive and indolent disease; and (v) prostate cancer patients managed by different treatments with information linked to long-term clinical follow up data in many cases.This study contains the samples from the Danish prostate group.

  Study EGAS50000001616

• Quantitative microbiome profiling disentangles inflammation- and bile duct obstruction-associated microbiota alterations across IBD/PSC diagnoses

  Disease-association microbiome dataset comprising 106 primary sclerosing cholangitis and/or inflammatory bowel disease (PSC/IBD) patients. Assessing quantitative taxon abundances, we study microbiome alterations beyond symptomatic stool moisture variation. We observe a high prevalence of a low cell count Bacteroides2 enterotype across patient groups when compared to healthy controls, with microbial loads correlating inversely with intestinal and systemic inflammation markers. Quantitative analyses allow us to differentiate between taxa associated to either intestinal inflammation severity (Fusobacterium) or cholangitis/biliary obstruction (Enterococcus) among previously suggested PSC marker genera. We identify and validate a near-exclusion pattern between the inflammation-associated Fusobacterium and Veillonella genera, with Fusobacterium detection being restricted to Crohn’s disease (CD) and PSC-CD patients. Overall, through absolute quantification and confounder control, we single out clear-cut microbiome markers associated to pathophysiological manifestations and disease diagnosis.

  Study EGAS00001003600

• Detection of low-frequency DNA variants by targeted sequencing of the Watson and Crick strands

  Identification and quantification of low-frequency mutations remain challenging despite improvements in the baseline error rate of next-generation sequencing technologies. Here, we describe a method, termed SaferSeqS, that addresses this challenge by (1) efficiently introducing identical molecular barcodes in the Watson and Crick strands of template molecules and (2) enriching target sequences with strand-specific PCR. The method achieves high sensitivity and specificity and detects variants at frequencies below 1 in 100,000 DNA template molecules with a background mutation rate of <5 × 10-7 mutants per base pair (bp). We demonstrate that it can evaluate mutations in a single amplicon or simultaneously in multiple amplicons, assess limited quantities of cell-free DNA with high recovery of both strands and reduce the error rate of existing PCR-based molecular barcoding approaches by >100-fold.

  Study EGAS00001005048

• IYDP Indonesian Y chromosome Diversity Project

  Island Southeast Asia and Oceania host one of the world’s richest assemblages of human phenotypic, linguistic and cultural diversity. We compiled ~9.7 Mb of Y chromosome sequence from a diverse sample of over 380 men from this region, including 126 from Indonesian islands, first reported here. The granularity of this dataset allows us to fully resolve and date the regional Y chromosome phylogeny. This improved Y chromosome topology highlights localized events with important historical implications, including pre-Holocene contact between Mainland and Island Southeast Asia, ongoing interactions between Australia and the Papuan world, and a sustained period of diversification following the flooding of the ancient Sunda and Sahul continents as the insular landscape of today formed. The high-resolution phylogeny of the Y chromosome presented here thus enables a detailed exploration of past isolation, interaction and change in one of the world’s least understood regions.

  Study EGAS00001006028

• Application of high-throughput, high-depth, targeted single-nucleus DNA sequencing in pancreatic cancer

  Despite insights gained by bulk DNA sequencing of cancer it remains challenging to resolve the admixture of normal and tumor cells, and/or of distinct tumor subclones; high throughput single-cell DNA sequencing circumvents these and brings cancer genomic studies to higher resolution. However, its application has been limited to liquid tumors or a small batch of solid tumors, mainly because of the lack of a scalable workflow to process solid tumor samples. Here we optimized a highly automated nuclei extraction workflow that achieved fast and reliable targeted single-nucleus DNA library preparation of 38 samples from 16 pancreatic ductal adenocarcinoma (PDAC) patients, with an average library yield per sample of 2867 single nuclei. We demonstrate that this workflow not only performs well using low cellularity or low tumor purity samples but reveals novel genomic evolution patterns of PDAC as well.

  Study EGAS00001006024

• Single-cell RNA-seq of bronchoalveolar lavage (BAL) fluid in severe COVID-19 and SARS-CoV-2 stimulated classical blood monocytes

  We analyzed pulmonary monocyte and macrophage responses as well as and pulmonary pathology in two cohorts of patients with COVID-19 associated ARDS. Monocyte-derived macrophages accumulated in the lung during ARDS and acquired a profibrotic signature, characterized by high expression of known fibrogenic factors like TGFB1, SPP1 and LGMN. COVID-19 associated macrophages showed highly significant transcriptional similarity with profibrotic macrophage populations identified in idiopathic pulmonary fibrosis (IPF). Notably, overnight exposure to SARS-CoV-2, but not influenza A virus or viral RNA analogues, induced a similar phenotype in human monocytes from healthy volunteers in vitro. Patients with severe COVID-19 associated ARDS showed clear clinical, radiographic and histopathological features of scarring and fibrotic tissue remodeling. In conclusion, SARS-CoV-2 triggers profibrotic macrophage responses, fibroproliferative ARDS, and lung fibrosis

  Study EGAS00001004928

• single-stranded DNA study

  A ssDNA library protocol was applied to cfDNA from plasma samples obtained from different DNA extraction methods and revealed significant differences in DNA fragmentation patterns in comparison to dsDNA-based protocols. In particular, a specific combination of methods revealed a population of ultrashort fragments, organized at ~50 bp. We observed significant differences in the relative abundance of these ultrashort DNA fragments in plasma from healthy individuals and cancer patients. Through shallow whole genome sequencing (sWGS, <0.5-fold coverage) and the analysis of somatic copy number aberrations (SCNA), we determined the landscape of genetic alterations in this newly identified population of cfDNA fragments. In addition, we studied their potential link with regulatory regions by investigating the genome-wide coverage patterns at transcription start sites (TSS). Furthermore, we demonstrated that the ultrashort cfDNA fragments map to regions associated with secondary DNA structures, G-quadruplexes (G4s).

  Study EGAS00001005093

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178