17558 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 43.92 milliseconds.

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• MEC/SEF DNA-seq

  DNA sequencing of 27 MEC/SEF tumor samples. Whole exome sequencing was performed at Beijing Genomics Institute using a library preparation based on Agilent V6(60M). Sequencing was performed on the DNBseq platform sequencer with a read length of 100PE, producing ~12G raw data per sample.

  Dataset EGAD50000000762

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• WGS of a hepatoblastoma patient with atypical tetrasomy 18

  WGS was performed on 4 samples from a hepatoblastoma patient with atypical tetrasomy 18. 2 hepatoblastoma samples (1 diagnostic biospy and 1 resected tumor), 1 blood sample and 1 non-tumor liver sample were sequenced.

  Dataset EGAD00001015507

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• A Phase II Study: CRS207/GVAX Plus Anti-PD1 and Anti-CTLA4 Recruits Mesothelin- and KRAS-Specific T cells into PDAC

  This study examined immunologic correlatives from a phase II study evaluating CRS207/GVAX vaccines in combination with anti-PD1 and anti-CTLA4 in metastatic pancreatic cancer (NCT03190265). Arm A received CRS207/GVAX with anti-PD1 and anti-CTLA4 therapy; Arm B received CRS207 with anti-PD1 and anti-CTLA4 therapy. Patients undergoing treatment in this trial had peripheral blood mononuclear cells (PBMCs) and tumor tissue biopsied serially at pre-treatment and on-treatment timepoints. Single-cell RNA/TCR sequencing was employed on PBMCs. Bulk RNA/TCR sequencing was employed on tumor tissues. We identified treatment-enriched inflammatory pathways as well as T cell repertoires.

  Study phs003798

• Proteomic Characterization of Intrahepatic Cholangiocarcinoma Identifies Risk-Stratifying Subgroups, Proteins Associated with Time-To-Recurrence, and mTOR Effector Molecule EIF4A1 as a Druggable Therapeutic Target

  Using mass spectrometry-based proteomics, we analyzed two independent cohorts comprising 80 and 62 treatment-naive ICC tumors, 67 adjacent non-malignant tissues, and 9 patient-derived xenografts (PDX). In the first cohort, we identifed two subclusters with distinct times-to-recurrence (TTR). A 4-protein classifier trained on our data cohort accurately stratifies these ICC clusters in the Dong et al. dataset (2022) and in our independent second cohort, revealing similar associations between proteomic motifs and clinical outcomes. The Translation regulator EIF4A1 emerges as a therapeutic target, as its inhibition with novel drug eFT226 significantly reduces tumor growth in an ICC PDX model.

  Study EGAS50000001343

• EHMT2 alterations cause a Kleefstra-like syndrome

  We report clinical and molecular correlates associated with six de novo EHMT2 variants identified in patients presenting with a Kleefstra syndrome–like phenotype. Transcriptomic profiling of patient-derived fibroblasts and induced pluripotent stem cells (iPSCs) reveals shared gene expression signatures between EHMT2 variant carriers and Kleefstra syndrome, compared with cell lines derived from healthy donors.

  Study EGAS50000001637

• Three large nuclear families in which a single child per family was diagnosed with cancer

  We collected saliva samples from three nuclear families having 4, 5, and 7 children, respectively. One child in each nfamily had been diagnosed with a pediatric tumor, and neither parent had been diagnosed with cancer. Diagnoses included Wilms tumor, low-grade astrocytoma, and Burkitt’s lymphoma, respectively. We used whole-genome sequencing to profile normal cells from each family member and a linked-read technology.

  Dataset EGAD00001007709

• 1M-scBloodNL

  Here we present the 1M-scBloodNL study, in which we performed single-cell RNA-seq on 120 individuals of the Northern Netherlands population cohort Lifelines. For each individual peripheral blood mononuclear cells (PBMCs) were sequenced in an unstimulated condition, and after 3 and 24 hour in vitro stimulation with C. albicans (CA), M. tuberculosis (MTB) and P. aeruginosa (PA), totalling approximately 1.3 million cells. scRNA-seq was conducted with the 10X Genomics 3'-end v2 (72 libraries) and v3 (33 libraries) technology. In general, each library contains PBMCs from 8 donors and 2 different stimulation-timepoint combinations. Donors were demultiplexed using a combination of SoupOrCell (https://www.nature.com/articles/s41592-020-0820-1) and genotype information to assign the correct donor to a donor-specific cell cluster.

  Dataset EGAD00001007764

• HGSC lines: ATACseq and RNAseq, pre- vs post-treatment with HKMTi-1-005

  Formation of a DAC to support the deposition of RNAseq and ATACseq data, from pre- vs post-treatment high-grade serous ovarian carcinoma cell lines. The lines include PEO1, PEO4, PEA2, OVCAR5, OVCAR8, and the treatment includes use of a novel epigenetic drug called HKMTi-1-005.

  Dac EGAC50000000034

• NINDS Inherited Forms of Motor Neuron Disease Study

  Sequencing data from primary fibroblasts were obtained from individuals with a family history of an inherited form of motor neuron disease (juvenile amyotrophic lateral sclerosis- ALS4).

  Study phs001322

• Human PI3Kγ Deficiency with Immunodeficiency and Tissue Immunopathology

  Whole exome sequencing of a trio (parents and offspring) reveals PIK3CG mutations that result in loss of protein in the child with immunodeficiency and immunopathology.

  Study phs001848

• BipEx_Landen_SWEBIC

  BipEx: Bipolar Exome Sequencing Broad & Karolinska Institutet. EGAS00001005860. "This research project was a collaboration between the Karolinska Institute and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of X SWEBIC Bipolar case samples from collaborators in Sweden. Genomic DNA from each samples was sequenced to a mean depth of 20x"

  Dac EGAC50000000142

• BipEx_Pedersen_Karolinska

  "BipEx: Bipolar Exome Sequencing Broad & Karolinska Institutet. EGAS00001005856. ""This research project was a collaboration between the Karolinska Institute BioBank and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 4,765 control samples from collaborators in Sweden. Genomic DNA from each samples was sequenced to a mean depth of 20x."" "

  Dac EGAC50000000141

• Exploring Genomic Mutations in Gastric Cancer among Japanese Populations

  We conducted a comprehensive analysis of whole-genome and RNA sequences obtained from biopsy samples of 65 patients with advanced gastric cancer prior to chemotherapy treatment.

  Study JGAS000754

• Metabolome analysis of persons with type 2 diabetes with or without diabetic complications

  We profiled serum metabolites of persons with T2D with or without diabetic complications using a comprehensive non-targeted metabolomics approach with mass spectrometry.

  Study JGAS000572