17558 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 22.13 milliseconds.

• Germline Aberrations of PAX5 Cause Susceptibility to pre-B cell Acute Lymphoblastic Leukemia

  A novel heterozygous germline variant, c.547G>A (p.Gly183Ser), in the paired box protein encoding gene, PAX5, was found to segregate with disease in two unrelated kindreds with autosomal dominant pre-B cell acute lymphoblastic leukemia (ALL). Leukemic cells from both families exhibited 9p deletion, with loss-of-heterozygosity and retention of the mutant PAX5 allele at 9p13 . Two additional sporadic ALL cases with 9p loss demonstrated PAX5 Gly183 substitution in the leukemic cells. Functional analysis of the PAX5 germline variants demonstrated reduced transcriptional activity, as well as decreased interaction with Groucho-4. These data extend the role of PAX5 alterations in the pathogenesis of pre-B ALL, and implicate PAX5 in a novel syndrome of germline susceptibility to pre-B cell neoplasia.

  Study EGAS00001000447

• Project for Development of Innovative Research on Cancer Therapeutics; Identifiying the predictive factors for response to chemoherapy in ovarian cancer

  To identify novel predictive biomarkers of response to chemotherapy for clear cell carcinoma of the ovary

  Study JGAS000076

• Count table for OAK (GO28915)

  This dataset contains counts for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008628

• Count table for POPLAR (GO28753)

  This dataset contains counts for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008630

• Epigenetic profiles of neuroblastoma PDXs

  This dataset contains bam files for ChIP-seq experiments for 6 neuroblastoma PDXs (Patient Derived Xenograft). It includes the bam files for the H3K27ac mark as well as the bam files of the corresponding input DNA for each sample.

  Dataset EGAD00001003394

• NFE2 and PF4 as Translational Biomarkers for BET Inhibition-Induced Thrombocytopenia in Preclinical and Clinical Studies

  Blood samples from patients treated with BMS-986158 were investigated for association with thrombocytopenia following BET inhibition. Hypotheses of translational biomarkers for early prediction of thrombocytopenia associated with BET inhibition were explored.

  Study EGAS50000001162

• Intellectual Disability cases with parents (trios) or affected sibs (sibpairs)

  Samples from ID cases negative for CNV through array-CGH were submitted to exome sequencing. Families with one affected individual underwent trio exome sequencing for identification of de novo variants. Families with more than one affected child underwent sibpair sequencing for identificatio of shared recessive or x-linked variants.

  Study EGAS00001003968

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

  B cells play a central role in the immune response to both SARS-CoV-2 infection and vaccination, but the development of the B cell receptor (BCR) repertoire in both contexts has not been defined nor compared. We analysed serial samples from 171 SARS-CoV-2-infected individuals with a range of disease severities together with 63 vaccine recipients, and found marked differences in the global BCR repertoire after natural infection compared to vaccination. Following infection, the proportion of BCRs bearing IgG1/3 and IgA1 isotypes increased, somatic hypermutation (SHM) was markedly decreased and, in patients with severe disease, expansion of IgM and IgA clones was observed. In contrast, after vaccination the proportion of BCRs bearing IgD/M isotypes increased, SHM was unchanged and expansion of IgG clones was prominent. Infection generated a broad distribution of SARS-CoV-2-specific clones predicted to target the spike protein whilst vaccination produced a more focused response mainly targeting the spike’s receptor-binding domain. These findings offer insights into how different immune exposure to SARS-CoV-2 impacts upon BCR repertoire development, potentially informing vaccine strategies.

  Study EGAS00001005816

• High-resolution analysis for urinary DNA jagged ends

  High-resolution analysis for urinary DNA jagged ends

  Study EGAS00001005603

• Dataset for the manuscript of Scywalker: scalable end-to-end data analysis workflow for nanopore single-cell transcriptome sequencing

  Dataset for the manuscript Scywalker: scalable end-to-end data analysis workflow for nanopore single-cell transcriptome sequencing. Contains fastq files for 4 brain samples obtained from short-read NovaSeq 6000 v1.5 Illumina and long-read Oxford Nanopore PromethION sequencing. Single-cell suspensions were generated using 10x Genomics Chromium Next GEM Single Cell 3'Kit v3.1

  Dataset EGAD50000000768

• Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study

  The Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study (NCT: NCT04750109) was sponsored by The Christie NHS Foundation Trust and funded by Innovate UK. Data generated include: A) Whole genome sequencing* of paired germline blood and tumour tissue B) Whole genome sequencing *of germline blood only C) Next-generation sequencing of circulating tumour DNA (FoundationOne Liquid CDX) D) Next-generation sequencing of tumour tissue (FoudationOne CDX) *Whole genome sequencing - germline sample at 30x coverage and somatic sample at 75x coverage performed by Illumina NovaSeq 6000 instrument in the 150bp PE read mode.

  Study EGAS00001008239

• DAC_RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Data access committee for RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Dac EGAC50000000352

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Pancreatic Cancer Sequencing Initiative OICR

  Pancreatic Cancer Sequencing Initiative for the International Cancer Genome Consortium at the Ontario Institute for Cancer Research.

  Study EGAS00001000395