17558 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 64.55 milliseconds.

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• Long-read sequence data from two carriers of a predisposing structural variant

  This dataset contains PacBio long-read sequence data from two individuals with a chr9p.21 structural variant and two controls. Sequences were aligned againt the human reference genome HG38.

  Dataset EGAD50000002155

• Whole-genome sequencing (WGS) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  We used WGS (Complete Genomics) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  Dataset EGAD00001003120

• Breast Cancer Family Registry Early-onset Breast Cancer GWAS

  In order to enhance our understanding of the genetic etiology of breast cancer, this study analyzed 1,265,548 Hapmap3 single-nucleotide polymorphisms (SNP) among a discovery set of 3,523 EOBC incident cases and 2,702 age-matched population control women, all of whom were age 50 or younger at enrollment. Subjects were recruited from the eight sites, some of which oversampled cases with a personal or family history of breast cancer.

  Study phs001589

• Whole-exome sequencing of Helicobacter pylori-uninfected normal gastric gland

  Recent studies showed that somatic mutations accumulate in normal tissues with age; however, mutation accumulation in the Helicobacter pylori-uninfected normal gastric mucosa has not been reported. A total of 18 biopsied gastric mucosa were obtained from nine subjects without Helicobacter pylori-infection or gastric cancer. Gastric epithelia were manually dissociated from the lamina propria. Subsequently, single glands were picked up under a stereomicroscope. Genomic DNA isolated from each gland was subjected to whole-exome sequencing.

  Study JGAS000313

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• DO NOT USE - Whole genome sequencing of SI-NETs from five patients

  Small intestine neuroendocrine tumor (SI-NET), the most common cancer of the small bowel, often displays a curious multifocal phenotype with several intestinal tumors centered around a regional lymph node metastasis, yet the typical path of evolution of these lesions remains unclear. Here, we determined the complete genome sequences of 37 tumors from 5 patients with multifocal SI-NET, allowing elucidation of phylogenetic relationships between multiple intestinal tumors and metastases in individual patients.

  Study EGAS00001004435

• A Comprehensive Catalogue of Somatic Mutations from a Human Cancer Genome

  A Comprehensive Catalogue of Somatic Mutations from a Human Cancer Genome

  Dataset EGAD00001000149

• Longitudinal multi-omics support immunotrhrombosis as the molecular force behind increased post-acute complication risk

  Whole blood transcriptome profiles in severe COVID-19 patients (n=81) across three timepoints: A) 1st day of hospital admission, B) one month (38.46 ± 12.89 days) post-hospitalization, and C) three months post-infection (96.29 ± 13.81 days post-hospitalization). 62 patients had blood collected at all three timepoints (19 patients have transcriptome data from two timepoints (acute phase (timepoint A) and recovery phase (timepoint B or C)), 224 blood transcriptomes in total.

  Study EGAS50000001430

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Spatial Heterogeneity in CLL

  A whole-genome/exome sequencing (WGS/WES) characterization of the spatial heterogeneity found in chronic lymphocytic leukemia (CLL) at diagnosis. Fifteen synchronous peripheral blood and lymph node samples were analyzed by WGS (n=2) or WES (n=13). Subtle differences in the global architecture of the tumor at peripheral blood and lymph node were observed only in a fraction of patients. Spatial heterogeneity was not found among the well-established CLL driver alterations.

  Study EGAS00001003803

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• The 5-hydroxymethylcytosine Landscape of Prostate Cancer

  This dataset consists of genome-wide 5hmC methylomes at various stages of prostate cancer, including not only 93 metastases from castration-resistant prostate cancer (mCRPC) patients, but also 5hmC patterns in cell-free DNA (cfDNA). There are 2000 runs in total as fastq files.

  Dataset EGAD00001008462

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428