17558 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 31.91 milliseconds.

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

  B cells play a central role in the immune response to both SARS-CoV-2 infection and vaccination, but the development of the B cell receptor (BCR) repertoire in both contexts has not been defined nor compared. We analysed serial samples from 171 SARS-CoV-2-infected individuals with a range of disease severities together with 63 vaccine recipients, and found marked differences in the global BCR repertoire after natural infection compared to vaccination. Following infection, the proportion of BCRs bearing IgG1/3 and IgA1 isotypes increased, somatic hypermutation (SHM) was markedly decreased and, in patients with severe disease, expansion of IgM and IgA clones was observed. In contrast, after vaccination the proportion of BCRs bearing IgD/M isotypes increased, SHM was unchanged and expansion of IgG clones was prominent. Infection generated a broad distribution of SARS-CoV-2-specific clones predicted to target the spike protein whilst vaccination produced a more focused response mainly targeting the spike’s receptor-binding domain. These findings offer insights into how different immune exposure to SARS-CoV-2 impacts upon BCR repertoire development, potentially informing vaccine strategies.

  Study EGAS00001005816

• Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study

  The Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study (NCT: NCT04750109) was sponsored by The Christie NHS Foundation Trust and funded by Innovate UK. Data generated include: A) Whole genome sequencing* of paired germline blood and tumour tissue B) Whole genome sequencing *of germline blood only C) Next-generation sequencing of circulating tumour DNA (FoundationOne Liquid CDX) D) Next-generation sequencing of tumour tissue (FoudationOne CDX) *Whole genome sequencing - germline sample at 30x coverage and somatic sample at 75x coverage performed by Illumina NovaSeq 6000 instrument in the 150bp PE read mode.

  Study EGAS00001008239

• Cancer_Cell_Line_Exome_Sequencing_

  Genomic characterisation of a large series of cancer cell lines.

  Study EGAS00001000978

• Breast_cancer_topographs

  Breast cancer topography will be explored using a combination of multi-region whole geome sequencing and in-situ RNA sequencing of fixed tissue specimens.

  Study EGAS00001003698

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line WXS

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009758

• Genomic Landscape of Human Skin at a Single-Cell Resolution

  Every cell in the human body has a unique set of somatic mutations, yet it remains difficult to comprehensively genotype an individual cell. Here, we developed solutions to overcome this obstacle in the context of normal human skin, thus offering the first glimpse into the genomic landscapes of melanocytes at single-cell resolution. We comprehensively genotyped 133 melanocytes from 19 sites across 6 donors. As expected, sun-shielded melanocytes had fewer mutations than sun-exposed melanocytes. However, within sun-exposed sites, melanocytes on chronically sun-exposed skin (e.g. the face) displayed a lower mutation burden than melanocytes on intermittently sun-exposed skin (e.g. the back). Melanocytes from donors with a history of skin cancer had higher mutation burdens than melanocytes from donors without skin cancer, implying that the mutation burden of normal skin can be harnessed to measure cumulative sun damage and skin cancer risk. Moreover, melanocytes from healthy skin commonly harbor pathogenic mutations, likely explaining the origins of the melanomas that arise in the absence of a pre-existing nevus. Phylogenetic analyses identified groups of related melanocytes, suggesting that melanocytes spread throughout skin as fields of clonally related cells, invisible to the naked eye. Overall, our study offers an unprecedented view into the genomic landscapes of individual melanocytes, revealing key insights into the causes and origins of melanoma.

  Study phs001979

• A comprehensive DNA methylation landscape of human and mouse cell lines derived from hematological malignancies

  Human cancer cell lines constitute useful models to study the primary disease and many relevant findings in tumor biology have been originated from them since the first immortalized cell line (HeLa) was obtained. The easy experimental intervention, the purity of the transformed cells and their versatility to undergo high-throughput screenings represent advantageous features of the established cancer cell lines. In recent years, major efforts have characterized in detail the multiomics make-up of hundreds of cancer cell lines and studied their association with sensitivity to anticancer drugs. Most of these studies have been genetic-centric and have not characterized in detail the epigenetic profiles underlying the characteristics of these cells or their impact on the efficacy of antitumoral compounds. In this regard, a past version of a DNA methylation microarray or a less accessible and more time-consuming such as reduced representation bisulfite sequencing have been used in those attempts to interrogate the epigenetic setting. Herein, we have obtained the DNA methylation profiles of 210 cell lines derived from hematological malignancies utilizing comprehensive DNA methylation microarrays that interrogates more than 850,000 and 285,000 CpG sites from human and mouse genomes, respectively. Importantly, we also provide a pharmacoepigenetic example of the potential use of this resource by showing how DNA methylation can predict response to nucleoside analogues.

  Study EGAS50000000627

• BipEx_Timpson_Bristol

  "BipEx_EGAS00001006274_Timpson_Bristol Controls Exomes. This research project was a collaboration between University of Bristol, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,981 Control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000144

• Massively Multiplex Single-Cell Hi-C of HeLa Cells

  In this study, we developed a massively multiplexed, single-cell Hi-C protocol to study the chromosomal architecture of single HeLa cells.

  Study phs001269

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of γδ T cells FACS sorted from peripheral blood of two Merkel cell carcinoma patients

  Dataset EGAD50000000137

• Genome-Wide Variations of End Motif in Cell-Free DNA Fragments Distinguish Immunotherapy Responders from Non-Responders in Head and Neck Cancer: A Multi-Institute Prospective Study

  Genome-Wide Variations of End Motif in Cell-Free DNA Fragments Distinguish Immunotherapy Responders from Non-Responders in Head and Neck Cancer: A Multi-Institute Prospective Study

  Dac EGAC50000000753

• Single Cell Sperm from fathers of Autistic Children

  Single cell sequencing of fathers who have had children with autism and fathers who have had multiple children, but no children with autism. The data was process on a 10X Chromium and sequenced on a NextSeq

  Dataset EGAD00001006292

• RNA-seq data from the tumor samples of a head and neck cancer patient

  This dataset contains paired-end RNA sequencing data (2x50 bp) from the three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006654

• Fungal infection in neural tissue from Amyotrophic Lateral Sclerosis

  The study shows that fungus infection, isolated from neural tissue, can be a risk factor to develop Amyothophic lateral sclerosis (ALS).

  Study EGAS00001002473

• Benchmarking DIA-type Proteomics Using Large-Scale Inter-Patient Heterogeneity Dataset

  Benchmarking Proteomics Quantitation in DIA-type data using real patient material to create a benchmark dataset comprising inter-patient heterogeneity

  Study EGAS00001005589