This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ We performed exome sequencing on serial samples from a patient with CMML who progressed to AML. The exome sequencing suggests that NPM1, TET2 and DNMT3a mutations were present in the dominant clone in the CMML sample and that NRAS is a new subclonal mutation in the AML sample. Diagnostic data shows the presence of a FLT3-ITD mutation in the AML sample, which is likely to have driven progression. Here we are performing re-sequencing of the putative driver and some passenger mutations which appear to be in the same clone to validate these mutations and to verify the relative quantification of these abnormalities .
Uploading files Users who hold an ega-box-XXX account can upload files using either INBOX or FTP. Users who have a Submitter role associated with their email will only be able to upload files using INBOX. Before uploading your files, please make sure that any files that will be uploaded to EGA do not use special characters in their naming convention, such as # ? ( ) [ ] / \ = + < > : ; " ' , * ^ | &. This can cause issues with the archiving process, leading to problems for end users. The EGA is a shared, public service with limited storage. To manage the available resources, we enforce a limit of 10TB per submission account at any one time. If you exceed this limit, a “permission denied” message will be displayed. This will prevent you from uploading more files, but connecting to your inbox.For submissions larger than 10TB, please perform uploads in 10TB batches: register all the metadata and then finalise the submission. Upload the next batch of files and repeat the same metadata registration and finalisation process until you have completed the file upload. Further information can be found in the SP documentation. INBOX FTP The INBOX is only compatible with files encrypted using the Crypt4gh tool Before uploading If you are not a registered EGA user, you will first need an EGA user account. Please note that it may take a few days for your account to be activated, as it needs to be vouched for by the EGA Helpdesk. Once your account is validated, you will be able to request a submitter role. [Optional] Meanwhile, you can create and add your public key to your EGA account profile. This option is not available for old submission accounts (e.g., ega-box-NNN). As soon as you have been granted a submitter role, you will be able to connect with your username and password to the EGA inbox using the SFTP protocol. If you have also registered a public key in your profile, you can also connect using this key. To upload files to your account, you can use the graphical user interface (GUI) or the command line. Graphical User Interface (GUI)We recommend using FileZilla, a free, open-source FTP client. However, you can use any other GUI that allows connecting over the SFTP protocol. For FileZilla as your GUI, follow these steps to upload files: Create a new connection in Site Manager (File > Site Manager) and select the following options (Figure 1): Protocol: SFTP - SSH File Transfer ProtocolHost: __EGA_INBOX_DOMAIN__Logon Type: Key fileUser: your EGA usernameKey file: Path/to/your/private_keyFigure 1: Process of establishing a new connection to __EGA_INBOX_DOMAIN__ using a key file as the logon method in FileZilla. The figure showcases the FileZilla version 3.52.2 operating on IOS v11.2.3. By following the depicted steps, users can create a secure and efficient connection to the inbox, ensuring seamless data transfers.Click Connect, and you will log in remotely to your home directory. You can think of this folder as a storage "in the EGA cloud" in which you will add your files for the EGA. The uploading area has three folders:To-encrypt: Files uploaded in this folder will be encrypted automatically on the fly.Encrypted: Files uploaded in this folder must already be encrypted with Crypt4gh. Upload your files here if your connection is unstable or you have problems completing the upload into-encrypt.Etc: This folder contains two files that allow the server to show you your username and group instead of some internal numbers. Please do not upload files here; otherwise, you will obtain a permission denied error. Find the files you want to upload by browsing your local storage (left side of your screen in FileZilla). Select all the files you want to upload, then right-click on them and select Upload (Figure 2). Figure 2: Step-by-step process of manually uploading files to __EGA_INBOX_DOMAIN__ using FileZilla, with FileZilla version 3.52.2 operating on IOS v11.2.3. The figure demonstrates how users can transfer data from their local storage to the "EGA cloud" by following the depicted steps Please note that regardless of which folder you upload your files in, both folders (to-encrypt, encrypted) will point to the same path (/) (Figure 3). Therefore, you will see your files in both folders. Figure 3: Both folders, to-encrypt and encrypted, point to the same path (/)" If your connection is unstable, please encrypt your files first using Crypt4gh. Then upload them to the ‘encrypted’ folder. The example above shows how to connect to __EGA_INBOX_DOMAIN__ using the private key. However, if you prefer to log in using your credentials, you can do so. Please go to the Frequently Asked Questions (FAQs) for more information. SFTP command line To upload files securely to your private area of the EGA, you can use SFTP(Secure File Transfer Protocol) with your favorite FTP client. Here's what you need to know to get started: Connect to the target host __EGA_INBOX_DOMAIN__. This is the new hostname for the EGA SFTP service. Log in with your EGA username and key files (or password). Upload files to your private EGA inbox to ensure that only you can access the files. By following these steps, you can securely upload your files to the EGA for safe storage and sharing. Using the SFTP command line client in Linux/Unix Open a terminal and type sftp username@hostnameEnter your EGA passwordTo see a list of available SFTP commands, type helpsftp> put – Upload filesftp> get – Download filesftp> cd path – Change remote directory to ‘path’sftp> pwd – Display remote working directorysftp> lcd path – Change the local directory to ‘path’sftp> lpwd – Display local working directorysftp> ls – Display the contents of the remote working directorysftp> lls – Display the contents of the local working directoryType the "put" command to upload files. For example: put *.bamUse the bye command to close the connection (SFTP session). After uploading- Once you have uploaded files to the inbox, please bear in mind that the checksum needs to be calculated, which can take up to two days. You will only be able to link your files to a run/analysis once the encrypted checksum has been calculated.- When linking your files to the 'Run' or 'Analysis', ensure that the file name matches the file path '/name' in the INBOX folder.- Please delete the files from your SFTP INBOX after all the runs/analyses have been registered and files are ingested (SP > Files > Files ingested). This will clear your inbox space an allow you to upload more files. This will also prevent the files from reappearing in your Submitter Portal inbox. Frequently Asked Questions Specific to the inbox What username should I use to log in to my inbox? The authentication process for logging in to the EGA website, as well as accessing your inbox and outbox, requires the use of your username. If you have forgotten your registered username, please contact our Helpdesk team for assistance. How are checksums calculated in your inbox? If you encrypt the file beforehand and upload it to the "encrypted" folder, the unencrypted checksum will not be calculated until the file is ingested (i.e., until it is used in a run/analysis). If the file is uploaded to the "to-encrypt" folder, then both checksums are calculated.Please bear in mind that after files have been uploaded to the inbox, the checksum must be calculated, which can take from a few hours to two days. Specific to using keys to authenticate Can I access one EGA account from different devices? Yes, you can access your account from different devices by linking several public keys to your EGA account. Each device can generate a unique public-private key pair, and the corresponding public keys can be linked to the same account. This way, you can use different public keys on different devices and still have access to the same account and data. I have several keys and I don't remember which one is which When generating SSH keys, it's a good practice to add a comment using the -C flag. This will allow you to add a descriptive tag to your key, making it easier to identify later on. Here's an example command that generates an SSH key with a comment: ssh-keygen -t ed25519 -C work-pass In this example, we're generating an ed25519 SSH key with the comment work-pass. Once you have multiple keys with different comments, you can use the comments to easily identify each key. To view the comments for your existing SSH keys, you can use the following command: ssh-keygen -l -f /path/to/key This will display the key fingerprint and the associated comment. By checking the comments, you should be able to identify which key is which. What if I can't find my SSH keys for uploading files with a key file, and how can I use new keys? If you can't find your SSH keys, don't worry - you can make new ones. To do this, open your terminal or command prompt and type a command to make a new SSH key. You can pick a name for the key, and choose a password to keep it safe. After making the key, you can add the new key to your account or server where you want to upload files using the key file. This usually involves copying and pasting the key's "public" (e.g. file.pub) part to the right place. If you lose track of the key again, just make a new one and add it again. Keep in mind that SSH keys belong to you and your computer, so if you switch computers or accounts, you'll need to make new keys. I don't want to type the passphrase every time I use the key. What can I do? You can use an ssh-agent to avoid typing the passphrase every time you use the key. An ssh-agent is a program that stores your private keys in memory and provides them to ssh when needed. You can add your key to the ssh-agent using the command ssh-add followed by the path to your key file.Here's an example of the steps to follow: Open a terminal window.Start the ssh-agent by typing the command eval $(ssh-agent).Add your key to the ssh-agent by typing the command ssh-add [key filepath]. For instance, if your key file is located in the home directory with the name mykey, the command will look like this: ssh-add ~/mykey After adding your, key to the ssh-agent, you should be able to use ssh without having to enter your passphrase every time. Can I use my password for authentication (without my private key)? If you prefer to use your username and password for authentication instead of your private key, you can still do so. When using a Graphical User Interface (GUI) such as FileZilla, you can select Ask for password as your Logon Type (Figure 3). This option will prompt you to enter your password when you click Connect, instead of using your private key. Figure 3: This option will prompt you to enter your password when you click "Connect", instead of using your private key. Figure 3: Process of establishing a new connection to __EGA_INBOX_DOMAIN__ using your password as the logon method in FileZilla. The figure showcases the FileZilla version 3.52.2 operating on IOS v11.2.3. By following the depicted steps, users can create a secure and efficient connection to the inbox, ensuring seamless data transfers. It's worth noting that using a password for authentication can be less secure than using an SSH key, as passwords can be more easily compromised through various means. However, if you choose to use your password for authentication, selecting "Ask for password" as your Logon Type is a good way to do so securely via a GUI. Why is it better to use my key and not my password? SSH keys for authentication is generally considered to be more secure and convenient than using passwords. SSH keys are more difficult to crack than passwords, and they can be restricted to specific users and machines, giving you more control over access. Once you set up your SSH keys, you can use them to authenticate quickly and easily, without having to enter a password every time. This makes automation of tasks, such as uploading encrypted files, much simpler. Additionally, SSH keys provide better logging, allowing you to keep track of who is accessing your systems and when. All in all, using SSH keys is a good practice for improving security and convenience in your authentication process.
These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.
Massive genomic rearrangement acquired in a single catastrophic event during cancer development
This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.
To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.
We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.
This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.
A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.
This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.
RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma
Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.
WGS and RNA-Seq data from a GBM patient PT-DF5919
WGS and RNA-Seq data from a GBM patient PT-AL4257
WGS and RNA-Seq data from a GBM patient PT-AR5365
WGS and RNA-Seq data from a GBM patient PT-RW9277
A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.
Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study
Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study
Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study
Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study
This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.
Germ cell tumors (GCTs) are the most common cancer in men between the ages of 15-40. While most patients are cured, those with disease arising in the mediastinum have distinctly poor outcomes. One in every 17 patients with primary mediastinal non-seminomatous GCTs develop an incurable hematologic malignancy and prior data intriguingly suggests a clonal relationship exists between hematologic malignancies and GCTs in these cases. To date however, the precise clonal relationship between GCTs and the diverse additional somatic malignancies arising in such individuals has not been determined. Here, we traced the clonal evolution and characterized the genetic features of each neoplasm from a cohort of fifteen patients with GCTs and associated hematologic malignancies. We discovered that GCTs and hematologic malignancies developing in such individuals evolved from a common shared precursor, nearly all of which harbored allelically imbalanced TP53 and/or RAS pathway mutations. Hematologic malignancies arising in this setting genetically resembled mediastinal GCTs rather than de novo myeloid neoplasms. Our findings argue that this scenario represents a unique clinical syndrome, distinct from de novo GCTs or hematologic malignancies, initiated by an ancestral precursor which gives rise to the parallel evolution of GCTs and blood cancers in these patients. Reprinted from PMID: 32897884, with permission from JCI.
