17535 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..Y2KA"

in 57.00 milliseconds.

• CcRCC_metabolic_heterogeneity

  Heterogeneity is a hallmark of clear cell renal cell carcinoma (ccRCC). In this study, hyperpolarized [1-13C]pyruvate MRI (HP-13C-MRI) was used to probe metabolic heterogeneity non-invasively in 6 ccRCC patients from which 58 tumor and healthy tissues biopsies were acquired postoperatively. MRI parameters were correlated with 146 metabolite concentrations and the expression of 2523 metabolic genes across 34 metabolic pathways. Using metabologram projections and pathway consensus scoring, several metabolic pathways were correlated with the metabolic MRI, including glycolysis, pentose phosphate pathway, and the TCA cycle. A simple thresholding approach applied to the imaging metrics was sufficient to provide meaningful metabolic pathway information. We also show that tissue metabolic heterogeneity increases in regions with higher pyruvate-to-lactate conversion on imaging. These results provide validation of the biological relevance of HP-13C-MRI and support the possibility of its clinical use to improve disease characterization, stratification, targeting of biopsies, and providing novel methods to monitor treatment response.

  Dataset EGAD00001015780

• Head and neck tumor organoid biobank for modelling individual responses to radiation therapy according to the TP53/ HPV status

  Head and neck cancers (HNC) represent an extremely heterogeneous group of diseases with a poorly predictable therapy outcome. Here, we have established a comprehensive molecularly and functionally characterized head and neck organoid biobank recapitulating the clinically relevant subtypes of TP53 mutant and human papillomavirus type 16 (HPV 16) infection-driven HNC. Organoids were exposed to radiotherapy and genetically engineered normal and tumor organoids were used for testing the direct functional consequences of TP53-loss and HPV infection. We identified subtype-associated transcriptomic signatures and pathological features, including sensitivity to TP53 stabilization by the MDM2 inhibitor Nutlin-3. TP53 loss-of-function alone was insufficient to promote radiation resistance, whereas HPV 16 oncogenes E6/E7 mediated radiosensitivity via induction of cell cycle arrest.

  Study EGAS50000001219

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• GBM Up and Down Responder EZH2 ChIPseq

  ChIPseq using anti-EZH2 with a sheared input DNA control to assess EZH2 genomic biding in one longitudinal pair of samples (pre- and post-treatment) from one UP and one DOWN responder GBM patient

  Dataset EGAD50000000134

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• The sanger result of LAM disease

  Tumor biopsies from LAM disease were analyzed by sanger to characterize the alterations in patients ,to elucidate the landscape of genetic/genomic alterations. The dataset include 21 samples.

  Dataset EGAD00010001761

• Genomic Alterations in Gingivo-buccal Cancer: ICGC-India Project_YR02

  Dataset EGAD00001001060

• Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina

  Study the sub-continental origins of African, European and Native American genetic ancestries of Argentinean populations.

  Study EGAS00001004492