16461 results for "sec+and+unspecified+malignant+neoplasm"

in 37.00 milliseconds.

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• Tumor Profiler Project - OV cell-free DNA data

  The dataset contains amplicon sequencing data from 48 samples from 35 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format.

  Dataset EGAD50000001410

• PRPH2-Related Retinal Dystrophies

  NGS dataset including patients affected by genomic variants at gene PRPH2. It includes NGS test using custom IRD gene panels, clinical exome sequencing (CES) and whole-exome sequencing (WES).

  Dataset EGAD50000001239

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• DDD-Africa Exome Sequencing

  1230 participants from both South Africa and The Democratic Republic of Congo underwent whole exome sequencing on an Illumina NovaSeq 6000 at Wellcome Trust Sanger Institute.

  Dataset EGAD00001015728

• Dataset for desmoplastic small round cell tumor - WGS

  This dataset contains 25 WGS sequencing samples of patients with desmoplastic small round cell tumor. Sequencing was performed on Illumina HiSeq X and NovaSeq 6000 using Illumina TruSeq Nano DNA Kit. The sequencing was always paired.

  Dataset EGAD50000000911

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• Bulk RNASeq of metastatic colorectal cancer organoids with ATOH1 knockout

  Bulk RNA sequencing was performed on mCRC organoids subjected to cetuximab treatment, comparing ATOH1 knockout and control conditions. The dataset is intended to elucidate the contribution of ATOH1-regulated secretory cell population to cetuximab persistence mechanisms.

  Dataset EGAD50000002060

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Prognostic markers of DNA methylation and NGS sequencing in progressive glioblastoma from the EORTC-26101 trial

  These dataset contains NGS data from 380 samples from the EORTC-26101 clinical trial for patients with progressive glioblastoma.

  Study EGAS00001007421

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• SEF tumor sequencing data

  This dataset contains samples from 8 patients with Sclerosing epithelioid fibrosarcoma. All 8 samples have whole exome tumor data and tumor RNAseq data. 3 samples also have matched normal dna sequence data.

  Dataset EGAD00001011100

• EFFORT occupationally exposed human stool metagenomes (148 samples)

  Metagenomes of stool samples from 54 pig farmers, 24 broiler farmers and 70 slaughter line workers. Note: Access to the data will only be granted for antibiotic resistance studies in accordance with the EFFORT consents issued by the participants.

  Dataset EGAD00001005444

• High-throughput sequencing data for study of molecular drivers of resistance to castration in localised prostate cancer

  Aligned whole-genome sequencing and RNA-seq of localised prostate cancer for study 'Loss of SNAI2 in prostate cancer correlates with clinical response to androgen deprivation therapy'.

  Dataset EGAD00001006640

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975