17871 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 49.51 milliseconds.

• RNA-seq and ATAC-seq data for ex vivo expanded T cells

  This dataset contains bulk RNA-seq and ATAC-seq data generated from naïve CD8+ T cells isolated from PBMCs of three healthy donors and stimulated ex vivo under multiple conditions. The dataset comprises 30 samples in total, including 15 RNA-seq samples and 15 ATAC-seq samples. Paired-end sequencing was performed on the Illumina NovaSeq 6000 platform. Raw data are provided as gzipped paired FASTQ files.

  Dataset EGAD50000002471

• Transcriptome analysis of patient-derived Schwann cells isolated from human sural nerve biopsies

  This dataset contains the transcriptome analysis of human Schwann cell cultures obtained from sural nerve biopsies from six patients with polyneuropathies (N=3/patient, totalN=18) as well as the nerve fascicles from where they were isolated (N=1/patient, totalN=6). In addition, this dataset includes 8 samples out of commercial human Schwann cell cultures and one sample of a fibroblast culture, which serve as controls for further analysis.

  Dataset EGAD50000001021

• ICARUS-BREAST01 Dataset

  A phase II clinical trial (NCT04965766) of patritumab deruxtecan in 99 breast cancer patients. Whole-exome sequencing (WES) is available for 43 tumor samples and 43 blood samples collected at entry into the trial. RNA-squencing is available for 44 samples comprising 22 samples collected at entry into the trial and 22 samples collected during treatment (cycle 1 day 3, cycle 1 day 19, or cycle 2 day 3) from 22 patients.

  Dataset EGAD50000000773

• Expression array

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed.
This dataset contains expression array data for 32 patients of the screening cohort with 8 of them having paired normal tissue plus an additional relapse tumor/normal pair of one of those 8 patients and a patient only with normal tissue. Data was generated on a HumanHT-12 v4 Bead Array (Illumina) and is stored in IDAT file format.

  Dataset EGAD00010002596

• The spatial organization of intratumor heterogeneity and evolutionary trajectories of metastasis in hepatocellular carcinoma

  A dataset consisting of Multi-regional Whole Exome Sequencing (WES) and Whole Genome Sequencing (WGS) data for 54 samples from 9 patients with hepatocellular carcinoma. The dataset includes 45 tumor samples and 9 normal blood samples. Selected somatic variants were validated by Sequenom. Patients covered are: Patient 1, Patient 2, Patient 3, Patient 4, Patient 5, Patient 6, Patient 7, Patient 8, Patient 9 and Patient 10.

  Dataset EGAD00001003138

• Exome sequencing of control DNA samples from patients with BPLL

  DNA extracted from sorted CD3+ cells (16 patients) was used for exome capture with the SureSelect V5 Mb All Exon Kit following the standard protocols. Paired-end sequencing (2 x 100 bp) was performed using HiSeq2000 sequencing instruments.The files are in FASTQ format.

  Dataset EGAD00001004411

• Whole exome sequencing data for Molecular Characterization of ETMRs

  This dataset contains exome sequencing data from 21 samples. Sequencing of samples using whole-exome sequencing was per- formed by creating libraries using the IlluminaTruSeq exome enrich- ment kit following the manufacturer’s instructions after size selection. Size selection was performed by fractionation using a Covaris ultra- sonicator and subsequent selection was performed using a 1.5% gel Pippin Prep cassette (Sage Science). One lane per sample has been sequenced resulting in 42 Fastq files (paired end).

  Dataset EGAD00001006210

• Multiple myeloma follow-up Dataset

  77 samples collected from 35 multiple myeloma patients. Each patient provided one healthy sample and one primary tumor sample and, in some cases, also samples collected after the progression of the disease.

  Dataset EGAD00001010161

• RNA-seq TPMs quantification for baseline tumor samples originating from IMpower150, and relevant clinical metadata

  This dataset includes full tumor transcriptomes from 558 advanced NSCLC tumors. These data originate from pre-treatment samples from a clinical trial for first-line non-small cell lung cancer (IMpower150). The patients in this trial were treated with the PD-L1 inhibitor atezolizumab +bevacizumab + chemotherapy or bevacizumab + chemotherapy or atezolizumab + chemotherapy.

  Dataset EGAD50000001814

• Bulk and Single-Nuclei RNA-seq with ATAC-seq of Breast Tumors Pre- and Post-Palbo ciclib/Endocrine Therapy

  This dataset comprises bulk and single-nuclei multiomic profiles from patients with ER+/HER2- early breast cancer enrolled in the NeoRHEA phase 2 trial. The bulk RNA-seq component includes 78 pre-treatment and 49 post-treatment tumor samples from 97 patients. The single-nuclei component includes matched pre- and post-treatment samples from 37 patients, totaling 63 samples analyzed by simultaneous snRNA-seq and snATAC-seq. Combined, the data contains bulk transcriptional profiles and single-nuclei gene expression/chromatin accessibility matrices for over 226,000 high-quality nuclei, encompassing tumor, immune, and stromal cells. Technologies used include Illumina NovaSeq 6000 for sequencing and the 10x Genomics Chromium platform (Multiome kit for single-nuclei, standard RNA library prep for bulk).

  Dataset EGAD50000002038

• GWAS on covid-19 severity and susceptibility in the province of Bergamo, Italy

  This is a case-control GWAS that involved the voluntary recruitment of inhabitants of the Bergamo province via an online questionnaire. We collected detailed clinical data and verified all information through personal interviews. Cases (severe COVID-19; G1) and controls (mild or asymptomatic COVID-19, G2; non-infected, G3) were matched by age, sex and risk factors

  Study EGAS00001007310

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma samples (99 FFPE tumor tissue derived DNA and 9 circulating tumor DNA) and corresponding germline DNA of 38 controls. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dac EGAC50000000261

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma cases. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dataset EGAD50000000546

• Next generation sequencing data of circulating tumor DNA and matched tumor tissues

  For each subject, genomic DNA from whole blood, circulating cell free DNA and tumor tissues (whenever possible) were performed targeting next generation sequencing on Illumina Miseq or Hiseq 4000 platforms. The sequencing results of whole blood were used to distinguish germline and somatic mutations. Specimens were collected from patients with different kinds of solid tumors, but most are lung cancer patients.

  Dataset EGAD00001003176

• Genomic Profiling of Advanced Pancreatic Cancer to inform therapy - RNA-Seq unmapped reads

  Genomics-Driven Precision Medicine for Advanced Pancreatic Cancer - Early Results from the COMPASS Trial - RNA-Seq unmapped reads

  Dataset EGAD00001003582

• Balanced Ependymoma

  We propose to definitively characterise the somatic genetics of a number of pediatric malignant tumours including ependymoma, high grade glioma and central nervous system primitive neurectodermal tumours through generation of comprehensive catalogues of somatic mutations by high coverage genome sequencing.

  Dataset EGAD00001000350

• Transcriptomic sequences of small intestinal Plasma cells from Celiac disease patients

  Transcriptomic sequences of small intestinal Plasma cell (PCs)s from Celiac disease patients. RNAseq data produced using Illumina paired-end (75bp) reads. Includes only raw data of sequences (fastq format). Samples from seven Celiac disease patients and four healthy controls. Samples from Celiac disease patients contain sub-groups of PCs that are either specific or not specific to autoantigen of the disease (TG2).

  Dataset EGAD00001004481

• Benchmarking CRISPR Whole-genome Drop-out Screen - B&S (2019-08-07)

  This study is a benchmarking exercise to explore potential source of variation between different CRISPR drop out libraries. . This dataset contains all the data available for this study on 2019-08-07.

  Dataset EGAD00001005233

• Whole exome sequencing of advanced gastric cancer

  To define the cellular characteristics of malignant ascites of advanced gastric cancer patients and search for therapeutic strategies, we obtained 5 malignant ascites and 1 cerebrospinal fluid from five patients with gastric cancer. We analyzed single-cell RNA-seq data of 180 cells from 4 malignant ascites and 1 cerebrospinal fluid metastasis using Fluidigm® C1™ System. Whole exome sequencing data was also generated from blood or tumor tissue.

  Dataset EGAD00001005740

• Single-nucleus Isoforms of Down Syndrome Brains (long-read)

  16 DS and Control brains samples were prepared using the 10X Genomics Single Cell 3' v3 kit. Pre-fragmented cDNA libraries were loaded onto a Pacific Biosciences Sequel II to sequence single-nucleus isoforms.

  Dataset EGAD00001008286

• BCG Molecular Subtyping

  Dataset for the paper: Non-muscle Invasive Bladder Cancer Molecular Subtypes Predict Differential Response to Intravesical Bacillus Calmette-Guérin

  Dataset EGAD00001010065

• Genomic and transcriptomic analysis of thymic epithelial tumors

  Thymic epithelial tumors (TETs), comprising various histologic types of thymomas and thymic carcinomas, originate from thymic epithelial cells. Each histologic type is typically associated with a distinct immune cell composition and clinical manifestation. A better understanding of the cellular origins and molecular pathways underlying this heterogeneity is needed to improve patient stratification and treatment. Here, we conducted an integrated genomic and transcriptomic analysis of 124 thymomas and 13 thymic carcinomas, including 20 newly sequenced cases combined with 117 cases from publicly available datasets. This approach stratified TETs into three subgroups with different possible origins: GTF2I-mutant (GTF2I-type) thymomas, copy number-altered (CN-type) thymomas, and thymic carcinomas.

  Study EGAS00001004227

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214