12450 results for ""non-traditional+communal+storytelling+approach"+novel+segment+noted+in+critical+commentary"

in 17.74 milliseconds.

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• single-cell RNA-seq Case-Control study of children progressing to Type1 diabetes

  It was a single-cell RNA sequencing study on the PBMC samples from four Finnish children at risk of developing Type 1 diabetes and their gender age and HLA matched control children. All four Case children were positive for multiple islet specific autoantibodies and two of them also progressed to clinical disease during the follow up whereas the control children remain negative for all autoantibodies. Single-cell analysis confirmed some of the signatures obtained from the bulk data. It identified that high IL32 in case samples in the bulk RNA-seq was contributed mainly by activated T cells and NK cells. Trajectory analysis of the scRNA-seq data suggested that IL32 expression increased as the T cells moved towards activated state.

  Dataset EGAD00001005768

• A non-canonical lymphoblast in refractory childhood T cell leukaemia

  Refractory cancers may arise either through the acquisition of resistance mechanisms by cancer cells or represent distinct diseases. The origin of childhood T-cell acute lymphoblastic leukaemia (T-ALL) that does not respond to initial treatment, i.e. refractory disease, is unknown. Refractory T-ALL carries a poor prognosis and cannot be predicted at diagnosis. Here, we performed single cell mRNA sequencing of T-ALL from children who did or did not respond to initial treatment. We identified a transcriptionally distinctive blast population, exhibiting features of innate-like lymphocytes, as the major source of refractory disease. Evidence of such blasts at diagnosis heralded refractory disease across independent datasets and was associated with survival in a large, contemporary trial cohort. Our findings portray refractory T-ALL as a distinct disease. They may have immediate clinical utility.

  Dataset EGAD00001015381

• Massive parallel RNA sequencing of highly purified mesenchymal cells derived from bone marrow specimens of 10 healthy donors

  Highly purified mesenchymal cells (CD45-/7AAD-/CD235a-/CD31-/CD271+/CD105+) were prospectively FACS-isolated from bone marrow specimens of 10 healthy donors (HDs). This data set is used as a baseline control to observe the differences between gene expression profiles (GEPs) of pre-leukemia cases (45 low-risk myelodysplastic syndrome, 4 Shwachman-Diamond and 3 Diamond-Blackfan anemia patients) and gene expression patterns observed in a normal, healthy context. Through differential expression and gene set enrichment analysis we determined that inflammatory signaling pathways are significantly more active in mesenchymal cells of pre-leukemia cases compared to their healthy counterparts. Finally, we determined through statistical modelling of healthy donor's GEPs which pre-leukemia cases have significantly more active inflammatory signaling and demonstrated a strong relation to survival statistics.

  Dataset EGAD00001002659

• MultiOMICS study of a pair of infant monozygotic twins with concordant B-cell ALL (WGBS)

  B-cell acute lymphoblastic leukemia (B-cell ALL) is the most common cancer in childhood. Studying identical twins with B-cell ALL provides a unique and tractable model for deciphering the developmental timing of pre- and post-natal mutations contributing to clonal evolution. To date, this has mainly focused on major cytogenetic subgroups of childhood B-cell ALL, including MLL fusions, ETV6-RUNX1, hyperdiploidy, and BCR-ABL1. However, formal demonstration of the prenatal origin and “backtracking” the natural history of the leukemia remains understudied in “B-other”/Normal Karyotype (NK) B-cell ALL. To characterize the epigenetic landscape of this particular leukemia subtype, we performed DNA bisulfite-sequencing on a pair of 8-month-old monozygotic twins diagnosed with concordant “B-other”/NK B-cell ALL.

  Dataset EGAD00001005018

• Recurrent/Metastatic Adenoid Cystic Carcinoma Treated with Axitinib and Avelumab

  Data from patients with adenoid cystic carcinoma treated with combination of VEGFR inhibitor axitinib and anti-PD-L1 avelumab. Eligible patients had R/M ACC with progression within 6 months before enrollment. The primary end point was objective response rate (ORR) per RECIST 1.1; secondary end points included progression-free survival (PFS), overall survival (OS), and toxicity. The study reached its primary end point with ≥4 PRs in 28 evaluable patients (confirmed ORR of 18%).

  Study EGAS50000001714

• Genome-wide DNA Methylation Data from Illumina HumanMethylationEPIC arrays for whole blood samples from 403 healthy individuals

  Genome-wide DNA Methylation Data from Illumina HumanMethylationEPIC arrays for whole blood samples from 403 healthy individuals. Additional associated phenotype information is available for all individuals included in this study directly from CIBMTR. Data are available under controlled access release upon reasonable request and execution of a data use agreement. Requests should be submitted to CIBMTR at info-request@mcw.edu and include the study reference IB17-04.

  Study EGAS00001006033

• The Gut Microbiome of liver transplant recipients – Cross-sectional + Longitudinal (renal and liver)

  TransplantLines is designed as a single-center, prospective cohort study and biobank including all different types of solid organ transplant recipients as well as living organ donors. In the TransplantLines gut microbiome study the gut microbiome of solid organ transplant recipients is characterized and linked to clinical phenotypes. This batch contains the cross-sectional data from liver transplant recipients and longitudinal data from renal and liver transplant recipients.

  Study EGAS00001006258

• EGAD00010000628

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000628

• EGAD00010000630

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000630

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• DNAmet

  DNAmet analysis of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Dataset EGAD50000001531

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• snRNAseq prostate cancer

  single-nucleus RNA seq characterization of human fresh frozen prostate cancer samples and non-malignant controls for the same patients. Biopsies were sectioned in 100 micron thick sections, adjacent to those used for spatial transcriptomics.

  Dataset EGAD50000001633

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267