7190 results for "({!join from=dataset_studies to=id v=$q1}) OR ("transcriptome" OR "RNA-seq" OR "rna sequencing" OR "rna-sequencing")"

in 284.31 milliseconds.

• RNA-seq transcriptome of bronchial brush samples from COPD and control

  Human subjects (COPD patients or apparently healthy controls) where investigated by bronchoscopy and a 5 mm brush was used to sample the subsegment airways of the right lung. The material obtained mainly consist of bronchial epithelial cells plus some contamination with leukocytes. For further details see Ziegler-Heitbrock et al, European Respiratory Journal, 40:823-829, 2012.

  Dataset EGAD00001002003

• RNA-seq analysis of TGF-β-induced transcriptional changes in 19TT cancer-associated fibroblasts

  The dataset contains 6 samples, three biological replicates for vehicle-treated 19TT cells, and three biological replicates for TGF-β-treated 19TT cells. The dataset was generated by the next generation high throughput sequencing. Strand specific transcriptome library construction is completed by enriching mRNA from total RNA, sequenced by DNBSEQ high throughput platform.

  Dataset EGAD50000001350

• ImmuNEO CD8 cell lines

  Paired RNA-Seq data from 16 samples of different tumors CD8+ T cells added to the study "Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)". Sequencing was performed on Illumina NextSeq 500. The sequencing was always paired

  Dataset EGAD50000000193

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• High-throughput sequencing data for study of molecular drivers of resistance to castration in localised prostate cancer

  Aligned whole-genome sequencing and RNA-seq of localised prostate cancer for study 'Loss of SNAI2 in prostate cancer correlates with clinical response to androgen deprivation therapy'.

  Dataset EGAD00001006640

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Dataset for RNA and Exome sequencing of Glioblastoma samples

  This dataset contains RNA Seq, 10x scRNA Seq and Exome sequencing of glioblastoma samples. Sequencing was performed on a Illumina NovaSeq 6000 and Illumina HiSeq 4000. The sequencing was always paired.

  Dataset EGAD00001012235

• An Integrated Approach to Patient Stratification and Therapy Selection in Acute Myeloid Leukemia

  As more clinically-relevant genomic features of myeloid malignancies are revealed, it has become clear that targeted clinical genetic testing is inadequate for risk stratification. Here, we developed and validated a clinical transcriptome-based assay for stratification of acute myeloid leukemia (AML). Comparison of RNA-Seq to whole genome and exome sequencing revealed that as a standalone assay, RNA-Seq offered the greatest diagnostic return, enabling identification of expressed gene fusions, single nucleotide and short insertion/deletion variants, and whole-transcriptome expression information. Expression data were used to develop a novel risk score which, when combined with molecular risk guidelines, allowed for the re-stratification of 22.1 to 25.3% of AML patients from three independent cohorts into correct risk groups. Within the adverse-risk subgroup, we identified a subset of patients characterized by dysregulated integrin signaling and RUNX1 or TP53 mutation. We show that these patients may benefit from therapy with inhibitors of focal adhesion kinase (PTK2), demonstrating additional utility of transcriptome-based testing for therapy selection in myeloid malignancy.

  Dataset EGAD00001006701

• Evolutionary Analysis of Chronic Lymphocytic Leukemia Cells During Relapse After Allogeneic Hematopoietic Stem Cell Transplant

  We investigated the molecular dynamics driving relapse of chronic lymphocytic leukemia (CLL) following allogeneic hematopoietic stem cell transplant (allo-HSCT) through an integrated analysis of whole exome, bulk transcriptome, bulk methylome and single cell transcriptional data from paired leukemic samples representing 19 patients. We found that their clinical kinetics corresponded to distinct genetic and epigenetic evolutionary trajectories and suggest that the selection pressures of the post-transplant, immunologic bottleneck are distinct from those imposed by chemotherapy.In order to discover cancer antigens derived from annotated and unannotated protein-coding regions of the genome, we carried out ribosome profiling (Ribo-seq) and RNA-sequencing on CLL samples and isolated primary B cells from healthy donors. We discovered novel or unannotated open reading frames (nuORFs), their expression levels, as well as somatic mutations within them to predict potential neoantigens.

  Study phs001998

• Identification and characterization of tertiary lymphoid structures in brain metastases

  Brain metastases (BrM) are the most common cancers in the brain. We performed transcriptome-wide gene expression profiling combined with spatial immune cell profiling to characterize the tumor immune microenvironment in BrM from different primary tumors. We found that BrM from lung carcinoma and malignant melanoma showed overall higher immune cell infiltration as compared to BrM from breast carcinoma. RNA sequencing-based immune cell deconvolution revealed gene expression signatures indicative of tertiary lymphoid structures (TLS) in subsets of BrM from lung cancer and melanoma. This finding was corroborated by multiplex immunofluorescence staining of immune cells in BrM tissue sections. Detection of TLS signatures was associated with prolonged survival after BrM diagnosis in lung cancer patients. Our findings highlight the cellular diversity of the tumor immune microenvironment in BrM of different cancer types and suggest a role of TLS formation for BrM patient outcome.

  Study EGAS50000000563

• Single-cell omics data for COVID-19 patients

  Single-cell RNA-seq, single-cell ATAC-seq, and genotypes used in the analysis for the study "Altered and allele-specific open chromatin landscape reveal epigenetic and genetic regulators of innate immunity in COVID-19". The RNA-seq and ATAC-seq are raw data in FASTQ format while the genotypes are in the VCF format which was filtered and imputed (more details are available in the main text of the study).

  Dataset EGAD00001009331

• Paired RNA-Seq data of Primary lymphomas of the central nervous system (PCNSL)

  Primary lymphomas of the central nervous system (PCNSL) are diffuse large B-cell lymphomas (DLBCLs) which are confined to the central nervous system (CNS). Paired RNA-Seq sequencing was done on Illumina HiSeq2000 machines using Illumina TruSeq RNA library preparation kit. About 36 tumor samples were sequenced.

  Dataset EGAD00001007811

• Datasets of RNA-seq of tumor samples from clear cell renal cell carcinoma patients included in the Translational Program of the NIVOREN GETUG-AFU-26 trial

  RNA-seq analyses were performed on tumor tissue samples of 115 advanced clear cell renal cell carcinoma patients who participated in the NIVOREN GETUG-AFU-26 trial. The samples were obtained prior to treatment initiation. RNA-seq was performed to evaluate previously published gene expression signatures. These included: the IMmotion T effector (CD8A, EOMES, PRF1, IFNG and CD274) and the IMmotion Myeloid (IL-6, CXCL1, CXCL2, CXCL3, CXCL8, and PTGS2) gene signatures represent gene expression patterns associated with T effector cells and myeloid cells, respectively, while JAVELIN Renal 101 Immuno (T-cell receptor signaling: CD3G, CD3E, CD8B, THEMIS, TRAT1, GRAP2, CD247; T-cell activation, proliferation, and differentiation: CD2, CD96, PRF1, CD6, IL7R, ITK, GPR18, EOMES, SIT1, NLRC3; Natural killer cell mediated cytotoxicity: D2, CD96, PRF1, CD244, KLRD1, SH2D1A; Chemokine: CCL5, XCL2; and Other immune response genes: CST7, GFI1, KCNA3, PSTPIP1) represents gene expression patterns associated with both innate and adaptive immune response.

  Dataset EGAD50000001541

• A Pilot Study of Rapid Autopsy and Procurement of Tissue in Thoracic Malignancy Cancer Patients to Investigate Tumor Heterogeneity

  Integrated proteo-genomics studies to characterize tumor heterogeneity of metastatic lung adenocarcinoma and thymic carcinoma are lacking. We carried out whole exome sequencing, RNA sequencing, copy number estimation and mass spectrometry-based proteomics of 40 tumors from five rapid/warm autopsy patients. We found highly variable mutational heterogeneity that was largely driven by APOBEC-mutagenesis with the expression of APOBEC3B (Gene ID: 9582) and APOBEC3A_B (Gene ID: 100913187) due to underlying APOBEC3 region germline variants as the likely mediating mechanism. APOBEC3A_B expression was associated with increased immune tumor microenvironment and CD274 (Gene ID: 29126) expression while smoking was associated with increased APOBEC-mutagenesis in TP53 (Gene ID: 7157) mutant tumors with high APOBEC3B expression. Heterogeneity at the level of the transcriptome and proteome occurred in association with copy number heterogeneity, not APOBEC-induced mutational heterogeneity. Arm and focal copy number alterations (CNAs) occurred as an evolutionarily late event in a subset of patients, with corresponding changes in the transcriptome and proteome, implicating CNAs as a driving force of heterogeneity in the evolution of metastatic disease.

  Study phs001432

• Reproducibility of 10x Genomics single cell RNA sequencing method in the immune cell environment

  Study EGAS00001005905