21187 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The process was smooth and quick..ivNx"

in 36.53 milliseconds.

• Genome and transcriptome sequence data from a metastatic pancreatic neuroendocrine patient

  Genome and transcriptome sequence data from a metastatic pancreatic neuroendocrine patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001005763

• Stage-specific gene and transcript dynamics in human male germ cells

  To study global transcriptional dynamics during human spermatogenesis we sequenced total RNA of human testicular biopsies with 5 specific histological phenotypes: Sertoli cell-only (SCO, n=3), spermatogenic arrests at the spermatogonial (SPG, n=4), spermatocyte (SPC, n=3), and spermatid (SPD, n=3) level, as well as normal spermatogenesis (Normal, n=3).

  Dataset EGAD00001008652

• Single-cell whole-genome sequencing of matched primary GBM tumours and patient-derived organoids

  Single-cell whole-genome sequencing of primary GBM tumours and matched patient-derived organoids. Obtained using the 10X Genomics single-cell CNV solution. Samples from two spatially distinct regions of five tumours from three patients (three primary, two recurrent).

  Dataset EGAD00001007937

• Genome and transcriptome sequence data from an unspecified tissue chordoma patient

  Genome and transcriptome sequence data from an unspecified tissue chordoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001008013

• Prostate cancer m6A epitranscriptome

  Using meRIP-sequencing, we profiled N-6 methyladenosine (m6A) in a cohort of 148 primary prostate cancer samples as part of the Canadian Prostate Cancer Genome Network project (CPC-GENE). Paired-end sequencing of 150 bp reads were mapped to GRCh38.p13 using annotations from gencode.v34.chr_patch_hapl_scaff.annotation.gtf. Peaks were called using MeTPeak, joint peaks were identified and IP reads were quantitated, normalized and adjusted using Input reads to obtain estimates of m6A abundance.

  Dataset EGAD00001009869

• Whole Genome Sequencing of Head and Neck Angiosarcoma

  This dataset contains 55 Whole Genome Sequencing of the study titled Spatial transcriptomics reveal topological immune landscapes of Asian head and neck angiosarcoma.

  Dataset EGAD00001010140

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010315

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010318

• ATAC-seq and RNA-seq datasets of CD14+ monocytes from healthy donors

  This dataset consists of functional genomic data from 6 healthy donors taken from CD14+ monocytes upon different immune stimulations. It contains 150 paired end fastq files consisting of 30 total RNA-seq samples across 4 runs and 30 ATAC-seq samples. The samples were sequenced on Illumina HiSeq4000 platform.

  Dataset EGAD00001011113

• Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient

  Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient,generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001015583

• Single-cell analysis of matched FFPE and frozen tissue samples reveals comparable resolution of intratumoural heterogeneity

  Testing the differences between FFPE and fresh frozen derived single cell results.

  Dataset EGAD00001015781

• The effects of bioinformatics preprocessing on cell-free DNA analysis

  The dataset contain 20 lung cancer and 20 healthy control cfDNA samples from plasma sequenced using 150bp PE sequencing.

  Dataset EGAD50000000213

• Childhood cerebellar tumors mirror conserved fetal transcriptional programs

  We used single-cell transcriptomics to study >60,000 cells from the developing murine cerebellum, and show that different molecular subgroups of childhood cerebellar tumors mirror the transcription of cells from distinct, temporally restricted cerebellar lineages.

  Dataset EGAD00001004318

• A compendium of mutational signatures due to environmental exposures

  Analysis of mutational signatures caused by exposure to known mutagens in human induced pluripotent stem (iPS) cells. A reference human iPS cell-line will be exposed to 100 chemicals known or proposed to be mutagenic. Following exposure to mutagen, cells will undergo a period of recovery before sub clones are generated and sequenced. The progenitor "parental" IPS cell-line will be used to generate reference sequence data, in order to determine the mutational signatures acquired as a result of exposure to different mutagens.

  Dataset EGAD00001005351

• BLUEPRINT EpiVar ChIP-seq for naive CD4+ T-cells

  BLUEPRINT EpiVar ChIP-seq for naive CD4+ T-cells

  Study EGAS00001000753

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339