15130 results for "cancer studies using rna-seq"

in 23.40 milliseconds.

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• DNA-seq BAM files from 16 patients affected by acute intermittent porphyria

  Paired-end BAM files from 16 patients affected by acute intermittent porphyria. Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001006951

• Rapid Acceleration of Diagnostics - Underserved Populations (RADx-UP) Collection of General Research Use Datasets

  This individual-level collection of datasets contains all the RADx Underserved Populations (RADx-UP) studies in dbGaP for General Research Use (GRU) and have no further limitations beyond those outlined in the model RADx Data Use Certification Agreement. Access to this study collection will include additional authorized individual-level GRU datasets that become available. Renewal of this study collection is required annually. Access to studies in this collection is on the RADx® Data Hub. To request access to this study collection, select phs003832 in the dbGaP when submitting a data access request.

  Study phs003832

• Rapid Acceleration of Diagnostics - Tech Program (RADx-Tech) Collection of General Research Use Datasets

  This individual-level collection of datasets contains all the RADx® Tech Programs (RADx-Tech) studies in dbGaP for General Research Use (GRU) and have no further limitations beyond those outlined in the model RADx Data Use Certification Agreement. Access to this study collection will include additional authorized individual-level GRU datasets that become available. Renewal of this study collection is required annually. Access to studies in this collection is on the RADx® Data Hub. To request access to this study collection, select phs003831 in the dbGaP when submitting a data access request.

  Study phs003831

• Rapid Acceleration of Diagnostics - Radical (RADx-rad) Collection of General Research Use Datasets

  This individual-level collection of datasets contains all the RADx® Radical (RADx-rad) studies in dbGaP for General Research Use (GRU) and have no further limitations beyond those outlined in the model RADx Data Use Certification Agreement. Access to this study collection will include additional authorized individual-level GRU datasets that become available. Renewal of this study collection is required annually. Access to studies in this collection is on the RADx® Data Hub. To request access to this study collection, select phs003834 in the dbGaP when submitting a data access request.

  Study phs003834

• Comprehensive Genomic Characterization of Translocation Renal Cell Carcinoma

  Xp11 translocation renal cell carcinoma (tRCC) is a rare, female-predominant cancer driven by a fusion between the TFE3 gene on chromosome Xp11.2 and a partner gene on either chrX or an autosome. It remains unknown what types of rearrangements underlie TFE3 fusions, whether fusions can arise from both the active (chrXa) and inactive X (chrXi) chromosomes, and whether TFE3 fusions from chrXi translocations account for the female predominance of tRCC. To address these questions, we performed haplotype-specific analyses of chrX rearrangements in tRCC whole genomes. We show that TFE3 fusions universally arise as reciprocal translocations and that oncogenic TFE3 fusions can arise from chrXi:autosomal translocations. Female-specific chrXi:autosomal translocations result in a 2:1 female-to-male ratio of TFE3 fusions involving autosomal partner genes and account for the female predominance of tRCC. Our results highlight how X chromosome genetics uniquely constrains somatic chrX alterations and underlies cancer sex differences.This version of the dbGaP study provides a comprehensive set of whole genome data and tables with clinical information collected for the 16 patients (15 pateints as tRCC and 1 patient as ccRCC) in the study cohort. The data also contains 12 RNA-seq samples used in the study and analyses. We anticipate that this data will considerably advance our molecular and genetic understanding of oncogenic translocations in TFE3-tRCC involving inactive chromosome X and its role in cancer sex bias.

  Study phs003008

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• Whole exome sequencing and RNA sequencing of patient-derived pancreas neoplasm organoids

  Pancreatic cancers arise from two different precursors; intraductal papillary mucinous neoplasms (IPMN) and pancreatic intraepithelial neoplasm (PanIN), while biological differences in cancers originated from them remain obscure. Here, we analyzed their genomic and transcriptomic landscapes using patient-derived organoids.

  Study JGAS000263

• Characterization of Leukemic Stem Cells in DNMT3Amut and NPM1mut AMLs

  Using a novel sorting strategy, we performed ultra low input RNAseq from FACS-sorted populations from diagnostic DNMT3Amut and NPM1mut AML patients. Primary samples were retrospectively collected based on their mutational profile. Samples were thawed, stained and FACS sorted using combination of lineage markers, CD34, GPR56 and NKG2DLigands. RNA was extracted and library prepared from 13 samples.

  Dataset EGAD00001009293

• Genomic Raw-Data

  Raw-Data of genomic studies (e.g WGS, WES data)

  Dac EGAC50000000210

• A Single-Cell and Spatial Atlas of Early Human Olfactory Development

  The human nasal region is a complex structure derived from neural crest and placodal lineages, but its development remains poorly understood due to limited fetal tissue access and its intricate architecture. To address this, we created a single-nucleus and spatial transcriptomic atlas of the human fetal nasal region using tissue from 10 fetuses between 7 and 12 post-conceptional weeks. Single-nucleus RNA sequencing (snRNA-seq) revealed 34 distinct cell types, including epithelial, cartilaginous, immune, neuronal, glial, muscular, and vascular cells. By integrating snRNA-seq with multiplexed error-robust fluorescence in situ hybridization (MERFISH), we tracked dynamic changes in cell composition and gene expression over time in the olfactory epithelium (OE) and surrounding nasal regions. We identified novel markers of olfactory sensory neuron development and key pathways regulating epithelial patterning and OE morphogenesis. Notably, we observed early molecular signatures consistent with the "one neuron-one receptor" model, with spatially organized expression of 171 olfactory receptor genes. Together, this study presents the first integrated molecular and spatial framework of early human nasal development. It offers an unprecedented molecular blueprint of olfactory system formation and serves as a foundational resource for embryologists and developmental biologists studying sensory neurogenesis, epithelial patterning, and congenital disorders.

  Dataset EGAD50000001712

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741