23227 results for "ega"

in 23.54 milliseconds.

• scRNA-seq from lung cancer organoids and immune cells

  15 scRNA-seq samples were multiplexed, and 5' 10X Chromium scRNA-seq was performed. This dataset provides the FASTQ files for the multiplexed data, as well as the BAM files for the demultiplexed samples.

  Dataset EGAD50000000845

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• fibroblast transcriptome of pediatric patients with epilepsy

  RNA sequencing of fibroblasts from pediatric patients with childhood epilepsy. Fibroblast RNA was extracted at passage 3-6 using MN nucleospin, >90M 150bp paired-end reads per sample were obtained with illumina sequencing. Reads were aligned to hg38.

  Dataset EGAD50000001166

• Dataset for early breast cancer samples

  This dataset contains WGS data for 27 tumor, control and patient derived culture samples of patients with breast cancer. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X using TruSeq Nano DNA Kit. The sequencing was always paired

  Dataset EGAD50000000860

• Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Study EGAS50000000773

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153