21206 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..JIZq"

in 25.94 milliseconds.

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Exome and RNA sequencing of pancreatic cancer biopsies and PDX models

  Pancreatic cancer biopsies and matching normal controls from 10 patients were exome sequenced. The same biopsies and PDX models derived from these were also subject to RNA sequencing.

  Dataset EGAD00001008113

• BMI EWAS summary stats

  Summary statistics for a multi-cohort epigenome-wide association study. This includes summary statistics (effect-size, standard error, p-value) for 470,000 methylation markers.

  Dataset EGAD00010001029

• An evaluation of different strategies for large-scale pooled sequencing study design.

  An evaluation of different strategies for large-scale pooled sequencing study design.

  Dataset EGAD00001000037

• DATA FILES FOR SJCPC-WGS

  DATA FILES FOR SJCPC-WGS

  Dataset EGAD00001001065

• Glioma sequencing data

  This study contains sequencing data for various glioma subtypes (astrocytoma, glioblastoma, diffuse midline glioma).

  Study EGAS00001006355

• Dataset for iAMP21 scRNA-seq

  10x Genomics 5' library scRNA-seq data for 4 iAMP21 patients

  Dataset EGAD00001009504

• PACA-CA Whole Genome Sequence bam files

  Merged bam files for PACA-CA Whole Genome Sequencing, for DCC release 25

  Dataset EGAD00001003591

• Single-cell transcriptional mapping reveals genetic and hierarchy-based determinants of aberrant differentiation in AML

  Therapeutic targeting of acute myeloid leukemia (AML) has in part been hampered by profound cell state heterogeneity among leukemia cells. To develop a more precise understanding of leukemia cell states in AML, we constructed a reference atlas of human hematopoiesis from 263,519 single cell transcriptomes spanning 55 cellular states. Using this atlas, we mapped over 1.2 million single-cell transcriptomes spanning 318 myeloid leukemia samples. This uncovered twelve recurrent patterns of aberrant differentiation in AML and additional leukemia cell states involving lymphoid and erythroid progenitors. Systematic mapping of genotype-to-phenotype associations revealed specific differentiation landscapes associated with >45 genetic drivers. Importantly, AML samples sharing common genetic driver alterations can have distinct cellular origins which inform the cellular identity of their disease-sustaining leukemia stem cell (LSC). Further, distinct LSC-driven hierarchies can co-exist within individual patients. Thus, precise mapping of malignant cell states provides insights into leukemogenesis, refines disease classification, and informs therapy development.

  Study EGAS50000000918

• DATA FILES FOR SJPHALL

  DATA FILES FOR SJPHALL

  Dataset EGAD00001000163