10741 results for "fc coins olx Navštivte Buyfc26coins.com Podpora pro profesionální hráče a týmy..zSiZ"

in 17.05 milliseconds.

• DNA-Sequencing of Baseline Plasma From the Phase III Alliance A031201 Trial

  Liquid biopsy assays tailored for metastatic castration-resistant prostate cancer (mCRPC) patients are needed to identify molecular alterations and predict survival in the context of androgen receptor (AR) inhibitors. We developed a novel plasma cell-free DNA (cfDNA) sequencing assay to detect circulating tumor DNA (ctDNA) and alterations in key mCRPC driver genes, and tested associations with clinical features and survival outcomes in a phase III trial. cfDNA was isolated from evaluable baseline plasma specimens of untreated mCRPC patients (n=790) enrolled in the Alliance A031201 randomized phase III trial (NCT01949337) prior to enzalutamide therapy with or without abiraterone acetate and prednisone. A customized targeted cfDNA sequencing assay was used to detect AR and non-AR alterations in mCRPC. For this, DNA-seq libraries were constructed from cfDNA using Takara ThruPLEX Tag-Seq or Plasma-Seq kits, and subjected to hybridization enrichment using a custom-designed Agilent SureSelect bait panel. Post-capture DNA-seq libraries were pooled and sequenced on an Illumina HiSeq 2500 using 2x150 bp settings. ctDNA positivity was defined as >20% ctDNA using an aneuploidy-based estimate derived from ichorCNA (Group 1) or a novel definition of ≤20% ctDNA, but with detection of any alteration in AR, or gain of MYC and/or MYCN (Group 2). cfDNA sequencing data was obtained from 776 patients. There were 480/776 (62%) ctDNA-positive patients, with 324 (42%) in Group 1 and an additional 156 (20%) in Group 2 with AR or MYC/MYCN alterations detected. ctDNA-positive patients in Groups 1 and 2 had similarly poor median overall survival (OS) of 25.4 months (95% CI: 21.8-29.0) and 29.7 months (95% CI: 27.3-35.5), respectively, as compared to ctDNA-negative patients who had a median OS of 49.1 months (95% CI: 42.3-53.5). Relative to ctDNA-negative patients, OS was inferior in ctDNA-positive patients in Group 1 (HR 2.3, 95% CI: 1.9-2.9, P AR inhibitors in a contemporary phase III trial.

  Study phs003325

• Automated machine-learning approach for next generation profiling of sequence alterations, mutation burden, microsatellite instability, and structural variants in human cancers

  Sequence and structural alterations together with tumor mutation burden (TMB) and microsatellite instability (MSI) have been identified as biomarkers for the determination of response to targeted and immune checkpoint inhibitor therapies. However, widespread clinical adoption of these biomarkers has historically been limited due to barriers such as evidence of clinical utility and reimbursement. We have developed 2.2 Mb targeted NGS system and an automated machine-learning analysis approach (PGDx elio™ tissue complete, ETC) that has been FDA cleared for examination of 500+ cancer-related genes and 68 mononucleotide repeats for identification of sequence and structural alterations, TMB, and MSI in solid cancers in a clinical setting. We designed and trained this approach using sequence data from 4,174 cancers and >124,000 in silico alterations and evaluated the methodology in >2,550 tumor or non-cancerous normal samples. Independent analyses of ETC sequence changes in 440 formalin fixed paraffin embedded (FFPE) tumor or cell line samples using MSK-IMPACT™, FoundationOne®, and ddPCR revealed a positive percent agreement (PPA) >97% with high sensitivity as low as 3% mutant allele fraction. We observed high concordance between panel-wide and whole-exome TMB for 307 pan-cancer FFPE tumors (Pearson r=0.95, p < 0.0001) using samples with ≥20% tumor cellularity. Comparison of the mutation context and repeat-based MSI approach in ETC with a multiplex MSI PCR assay in 223 samples revealed a PPA of 99% and negative predictive agreement (NPA) >99%. We confirmed the accuracy and precision of TMB and MSI measurements across three independent laboratories (CV of <5% and average PPA >99%, respectively). Finally, evaluation of amplifications and translocations against DNA and RNA-based approaches exhibited >98% NPA and PPA of 86% and 82% respectively. These results demonstrate high analytical performance for determination of sequence and structural changes, TMB, and MSI using a targeted NGS panel and provide a scalable and facile approach for evaluating these biomarkers in a clinical laboratory.

  Study EGAS00001005556

• Identifying transcriptional programs underlying anti-EGFR small molecule response and resistance with TraCe-seq

  Genetic and non-genetic heterogeneity within cancer cell populations represents a major challenge to anti-cancer therapies. We currently lack robust methods to determine how pre-existing and adaptive features affect cellular responses to therapies. Here, by conducting clonal fitness mapping and transcriptional characterization using expressed barcodes and single-cell RNA-sequencing, we have developed TraCe-seq, a method that captures at clonal resolution the origin, fate, and differential early adaptive transcriptional programs of cells in a complex population in response to distinct treatments. We used TraCe-seq to benchmark how next-generation dual EGFR inhibitors-degraders compare to standard EGFR kinase inhibitors in EGFR-mutant lung cancer cells. To QC the TraCe-seq strategy, single-cell RNA-seq libraries were generated from a variety of human cancer cell lines transduced with the TraCe-seq library to validate the TraCe-seq strategy. Specifically, 5 different cell lines (PC9, MCF-10A, MDA-MB-231, NCI-H358, and NCI-H1373) were each transduced with a unique TraCe-seq barcode. The transduced cells were selected with puromycin only, dissociated to single cell suspensions, and then mixed together. The complex mixture of the 5 cell lines was profiled by 10X scRNA-seq. Furthermore, transduced NCI-H1373 cells were sorted by FACS to enrich for the top 50% of eGFP positive cells, and sorted cells were cultured briefly and used to construct scRNA-seq libraries and profiled by 10x scRNA-seq. To carry out the full TraCe-seq experiment, ~600 PC9 cells carrying unique TraCe-seq barcodes were expanded over 12 doublings to establish the barcoded population. A subset of the barcoded PC9 population was used to generate scRNA-seq libraries and profiled by 10x scRNA-seq prior to treatment to establish a baseline transcription profile for each barcoded clone. The rest of the cells were then treated for four days with 1 µM erlotinib, 1 µM GNE-069, or 1 µM GNE-104 respectively. scRNA-seq libraries were then generated form the treated cells and profiled by 10x scRNA-seq.

  Study EGAS00001005405

• Institut Curie Neuroblastoma Whole Genome Sequencing Diagnosis Relapse

  Neuroblastoma, a clinically heterogeneous pediatric cancer, is characterized by distinct genomic profiles but few recurrent mutations. As neuroblastoma is expected to have high degree of genetic heterogeneity, study of neuroblastoma's clonal evolution with deep coverage whole-genome sequencing of diagnosis and relapse samples will lead to a better understanding of the molecular events associated with relapse. Samples were included in this study if sufficient DNA from constitutional, diagnosis and relapse tumors was available for WGS. Whole genome sequencing was performed on trios (constitutional, diagnose and relapse DNA) from eight patients using Illumina Hi-seq2500 leading to paired-ends (PE) 90x90 for 6 of them and 100x100 for two. Expected coverage for sample NB0175 100x100bp was 30X for tumor and constitutional samples. For the seven other patients expected coverage was 80X for tumor samples with PE 100x100, 100X in the other tumor samples and 50X for all constitutional samples (see table 1). Following alignment with BWA (Li et al., Oxford J, 2009 Jul) allowing up to 4% of mismatches, bam files were cleaned up according to the Genome Analysis Toolkit (GATK) recommendations (Van der Auwera et al., Current Protocols in Bioinformatics, 2013, picard-1.45, GenomeAnalysisTK-2.2-16). Variant calling was performed in parallel using 3 variant callers: GenomeAnalysisTK-2.2-16, Samtools-0.1.18 and MuTect-1.1.4 (McKenna et al., Genome Res, 2010; Li et al., Oxford J, 2009 Aug; Cibulskis et al., Nature, 2013). Annovar-v2012-10-23 with cosmic-v64 and dbsnp-v137 were used for the annotation and RefSeq for the structural annotation. For GATK and Samtools, single nucleotide variants (SNVs) with a quality under 30, a depth of coverage under 6 or with less than 2 reads supporting the variant were filter out. MuTect with parameters following GATK and Samtools thresholds have been used to filter our irrelevant variants. .SNVs within and around exons of coding genes overlapping splice sites.. Then,variants reported in more than 1% of the population in the 1000 genomes (1000gAprl_2012) or Exome Sequencing Project (ESP6500) have been discarded in order to filter polymorphisms. Finally, synonymous variants were filtered out. MuTect focuses on somatic by filtering with constitutional sample. Mpileup comparison between constitutional and somatic DNAs allowed us to focus also on tumor specific SNVs with GATK and Samtools. Finally, every SNV called by our pipeline and also supported in any constitutional samples were filtered our in order to prevent putative constitutional DNA coverage deficiency. Then we analyzed CNVs (copy number variants) with HMMcopy-v0.1.1 (Gavin et al., Genome Res, 2012) and control-FREEC-v6.7 (Boeva et al., Bioinformatics 2011) with a respective window of 2000bp and 1000 bp, and auto-correction of normal contamination of tumor samples for Control-FREEC. Finally we explored Structural variants (SVs) including deletions, inversions, tandem duplications and translocations using DELLY-v0.5.5 with standard parameters (Rausch et al., Oxford J, 2012). In tumors, at least 10 supporting reads were required to make a call and 5 supporting reads for the sample NB0175 with a coverage of only 40X (see table 2). To predict SVs in constitutional samples for subsequent somatic filtering, only 2 supporting reads were required in order not to miss one. To identify somatic events, all the SVs in each normal sample were first flanked by 500 bp in both directions and any SVs called in a tumor sample which was in the combined flanked regions of respective normal sample was removed (see graph 1). Deletions with more than 5 genes impacted or larger than 1Mb and inversions or tandem duplications covering more than 4 genes, were removed. We focused on exonic and splicing events for deletions, inversions, and tandem duplications. For translocation, we keep all SVs that occurred in intronic, exonic, 5'UTR, upstream or splicing regions. Bioinformatics detection of variations with Deep sequencing approach Once PE reads merged and adaptors trimmed by SeqPrep with default parameters, merged reads were aligned via the BWA (Li H. and Durbin R. 2009 PMID 19451168) allowing up to 1 differences in the 22-base-long seeds and reporting only unique alignments. Only reads having a mapping quality 20 or more have been further analysed. Variant calling software was not used, since we aimed to predict variations at low frequencies, observed in less than 1% of reads. Such variants require a custom approach. Using DepthOfCoverage functions of the Genome Analysis Toolkit (GATK) v2.13.2 (McKenna A, et al., 2010 Genome Research PMID: 20644199), we focused on high quality coverage of bases A, C, G and T at the targeted variant position. Depth of coverage of each base following a mapping quality higher than 20 and a base quality higher than 10 have been taken into account in order to focus only on high quality data. Aiming to determine the background level of variability at the studied regions, 10 control samples were included in the analysis. The same approach and filtering criteria have been applied as introduced above over the entire amplicons. In order to highlight variants, for each sample the frequencies of each bases at each amplicon position were then compared to those observed in the set of controls. Statistical analyses were performed with the R statistical software (http://www.R-project.org). Fisher’s exact two-sided tests with a Bonferroni correction were performed to compare percentages of bases between the data sets, i.e. for a given base between a case and the controls. Finally, significant variations were filtered-in once (i) a significant increase in the percentage of avariant base and (ii) a significant decrease in the percentage of it's reference base following our p.values criteria was observed (p.val < 0.05).

  Dataset EGAD00001001356

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Genome and transcriptome sequence data from a diffuse aarge B-cell lymphoma (relapse) tumor patient

  Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015308

• Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm tumor patient

  Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015312

• Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor tumor patient

  Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015322

• Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour tumor patient

  Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015327

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-RW9277

  WGS and RNA-Seq data from a GBM patient PT-RW9277

  Dataset EGAD00001004259

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Transcriptome sequencing of neuroendocrine tumors of the small intestine

  This dataset contains 206 RNASeq samples from a cohort of patients with neuroendocrine tumors of the small intestine. Libraries were prepared using a Illumina TruSeq Stranded mRNA kit following the manufacturer’s recommendations. Sequencing was performed on Illumina Novaseq6000 machine with a 2x75bp paired-end fashion. This dataset contains data for 169 tumors, 22 mesenteric nodules, 8 liver metastases, 2 adenomas, 1 lymph node and 4 normal ileum samples.

  Dataset EGAD50000000906

• Broad utility of ultrasensitive analysis of circulating tumor DNA (ctDNA) dynamics across solid tumors treated with immunotherapy

  Here, we applied a whole-genome, tumor-informed approach to study ctDNA in more than 202 advanced-stage cancer patients treated at VHIO. This study demonstrates the efficacy of ultrasensitive ctDNA as a broad biomarker in a large pan-cancer discovery and validation cohort, spanning 24 tumor types treated with diverse immunotherapy modalities. It demonstrates ctDNA’s potential for early response assessment, survival prediction, and distinguishing true progression from pseudoprogression, enhancing its clinical relevance. This dataset captures the plasma sequencing data from the project.

  Dataset EGAD50000001813

• Mid-frequency hearing loss is a characteristic clinical feature of OTOA-associated hearing loss

  In this study, we performed NGS analysis of a large Japanese hearing loss cohort, and identified 7 patients with OTOA-associated hearing loss. As novel clinical features identified in this study, the audiometric configurations of OTOA-associated hearing loss patients was found to be mid-frequency.

  Study JGAS000200

• CEITEC DAC

  A CEITEC Data Access Committee (DAC) is a body of one or more named individuals who are responsible for data release to external requesters. The members of DAC are selected members of research groups and their respective leaders. Multiple datasets may be affiliated to a single DAC. DAC continues communication with requester to understand the purpose of use, i.e. research setting the dataset is envisioned for by requester, to identify if data sharing is possible directly under current conditions for the dataset, or actions such as re-consenting is needed and desirable to accommodate the proposed research setting/data use.

  Dac EGAC50000000049

• Long-read sequencing identifies a common transposition haplotype predisposing for CLCNKB deletions

  Long-read whole genome sequencing, long-read long-range PCR sequencing, targetted long fragment long-read sequencing data of the CLCNKA/CLCNKB locus in 27 Bartter syndrome patients. Multiple different deletion alleles are identified and a new common transposition haplotype predisposing for CLCNKB deletions is described.

  Study EGAS00001007339

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• 120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  Study EGAS00001001733

• Oral microbiota composition assessed with 16S rRNA sequencing from adults aged over 65 years old.

  This is a oral microbiota amplicon dataset derived from adult participants aged over 65 years old. It consists a total number of 491 samples, stored in 982 paired-end FASTQ files with sequence lengths of 200 nucleotides generated with a Illumina MiSeq. Of those 491 samples, 347 were used in analysis, the remaining 144 samples are control samples.

  Dataset EGAD00001007705

• CRUK Accelerator: Non-small cell lung cancer whole exome and RNA sequencing

  Whole exome and RNASeq raw sequencing data for a cohort 24 patients with non-small cell lung cancer, 15 adenocarcinoma (8 female, 7 male) and 9 squamous cell carcinoma(5 female, 4 male). Median age at diagnosis was 69. Tumour tissue and PBMCs were used for whole exome sequencing and RNA sequencing. This data was generated as part of a study funded by a Cancer Research UK Centres Network Accelerator Award Grant (A21998).

  Dataset EGAD00001007934

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• Comprehensive RNA repository of tissue and plasma from patients with esophageal cancer or precursor lesions

  A comprehensive RNA repository (both coding and non-coding) from 17 patients diagnosed with esophageal adenocarcinoma, high-grade dysplastic or non-dysplastic Barrett’s esophagus. Per patient, a blood plasma sample, and a healthy esophageal and disease tissue sample were collected. This dataset includes both mRNA and small RNA sequencing data (fastq.gz files) of all tissue and plasma samples. In total,102 RNA-seq libraries from 51 samples (17 plasma and 34 tissue samples) were sequenced (plasma mRNA libraries were sequenced twice).

  Dataset EGAD00001006857

• Ultra-deep sequencing of cell-free DNA derived from reference materials and a patient with asymmetric overgrowth

  This dataset contains: Ultra-deep sequencing data using the Duplex sequencing technology of: 1.) SeraSeq cfDNA reference materials with spike-in variants with allele frequencies from 0% to 5% 2.) One cfDNA sample from a CRC patient 3.) One cfDNA sample from a patient with asymmetric overgrowth Paired-end sequencing was performed with 2x151 bp reads on the NextSeq 500 system. Data is provided as mapped .bam files (aligned to GRCh38/hg38).

  Dataset EGAD00001009784

• DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001005757

• ENU-LS-411N-TripleTherapy

  BRAF V600E colorectal cancers do not respond to the only currently FDA approved targeted therapy for CRC. There is currently a trial underway in the UK recruiting V600E CRC patients for treatment with a triple therapy combination of Cetuximab, Trametinib and Dabrafenib. We have mutagenized a pool of V600E CRC cell lines and treated with this triple therapy to select out drug resistant clones. We will now sequence these drug resistant clones with the aim of identifying common point mutations engendering resistance to this new therapy.

  Dataset EGAD00001002051

• Amplicon-based sequencing of drug resistant lung cancer cell lines (2017-07-05)

  A EGFR mutant NSCLC cell line which is sensitive to AZD9291 inhibition was mutagenised with the chemical mutagen ENU and then drug selected using a AZD9291. Single cell derived colonies were then manually picked and expanded in drug. Resistance was confirmed in a 14 day assay and DNA was collected. These then underwent targeted amplicon-based sequencing to confirm candidate resistance effectors hypothesised from currently available literature. This dataset contains all the data available for this study on 2017-07-05.

  Dataset EGAD00001003425

• Hip OA Functional Genomics RNAseq (2017-06-09)

  From 9 patients undergoing hip joint replacement surgery for osteoarthritis, we collected 3 cartilage samples each: a low-grade sample (no obvious evidence of damage or fibrillation); a high-grade sample (damaged and fibrillated cartilage); an osteophytic sample (overlaid bony protrusions mainly around the margins of the articular surface). Multiplexed libraries were sequenced on Illumina HiSeq 2000 (75bp paired-end read length) and a cram file was produced for each sample. This dataset contains all the data available for this study on 2017-06-09.

  Dataset EGAD00001003354

• Analysis of tumor periphery and center-specific mutations in renal cell carcinoma

  Renal cell carcinoma (RCC) is a genomically heterogeneous tumor. In the present project, the question whether intratumoral heterogeneity follows a zonal pattern indicating spatial niches was addressed. Whole exome sequencing of 16 paired samples from tumor periphery and center revealed a number of region-specific functional SNVs and Indels. Therefore, RCCs are not composed of evenly admixed tumor cells but show topological differences in their clonal composition.

  Dataset EGAD00001002067

• microRNA-seq of human serum from a longitudinal study of 66 women with no history of cancer

  This dataset includes microRNA sequencing data from 198 human serum samples, representing a subset of 66 women with no history of cancer who participated in the UKCTOCS study and with serum samples collected at three timepoints over a period of up to 5 years. Small RNA libraries prepared from the serum samples were sequenced with 50-bp single end reads on an Illumina HiSeq 2000 instrument. Data is provided as FASTQ files.

  Dataset EGAD00001004348

• Melanoma-Til Study RNAseq

  In this study, mutations present in a series of human melanomas (stage IV disease) will be determined, using autologous blood cells to obtain a reference genome. From each of the samples that are analyzed, tumour-infiltrating T lymphocytes have also been isolated. This offers a unique opportunity to determine which (fraction of) mutations in human cancer leads to epitopes that are recognized by T cells. The resulting information is likely to be of value to understand how T cell activating drugs exert their action.

  Dataset EGAD00001000325

• Whole exome sequencing of young onset Primary Sclerosing Cholangitis

  Primary sclerosing chloangitis is a rare autoimmune disease of the liver (prevalence =10/100,000) with a mean age of onset of 40 years. We are currently undertaking GWASand immunochip experiments to identify loci underlying PSC susceptibility. Through ourcollaborators at the University of Calgary we have access to DNA from three parent-offspringtrios where the children required liver transplants due to PSC before the age of 9. These areextremely rare cases indeed and we believe that exome-sequencing represents a powerfulmeans of identifying the causal mutation underlying this severe phenotype.

  Dataset EGAD00001000671

• RNASeq_EGAS00001001306

  RNASeq sequencing. Each library was sequenced using TruSeq SBS Kit v3-HS, in paired-end mode with a read length of 2 × 76 bp. We generated more than 20 million paired-end reads for each sample in a fraction of a sequencing lane on HiSeq2000 (Illumina Inc.) following the manufacturer’s protocol. Image analysis, base calling and quality scoring of the run were processed using the manufacturer’s software Real Time Analysis (RTA 1.13.48) and followed by generation of FASTQ sequence files.

  Dataset EGAD00001001443

• Sudden Cardiac Death in Heart Failure Trial (SCD-HeFT-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives The Sudden Cardiac Death in Heart Failure Trial (SCD-HeFT) was designed to evaluate the hypothesis that amiodarone or a conservatively programmed shock-only, single-lead implantable cardioverter defibrillator (ICD) would decrease the risk of death from any cause in a broad population of patients with mild-to-moderate heart failure. Background Patients with congestive heart failure (CHF) can die suddenly and unpredictably from arrhythmia despite the use of proven medical therapies, such as beta-blockade. Two approaches have been developed to prevent sudden death among patients with CHF: therapy with amiodarone and therapy with an ICD. However, most of the mortality data on amiodarone and ICD therapy at the time of the study had been obtained in clinical trials performed after myocardial infarction in patients without CHF or those with ventricular arrhythmias. Thus, more data was needed to guide these therapies in patients who did not meet these criteria. Participants There were a total of 2521 participants. 847 were randomly assigned to placebo, 845 to amiodarone, and 829 to ICD therapy. Design Before randomization, participants underwent electrocardiography, a 6-minute walk test, 24-hour ambulatory electrocardiography, liver and thyroid function studies, and chest radiography. Participants were required, if clinically reasonable, to receive treatment with a beta-blocker and an angiotensin-converting-enzyme inhibitor, as well as an aldosterone antagonist, aspirin, and statins, when appropriate. Participants were randomly assigned in equal proportions to receive placebo, amiodarone, or a single-chamber ICD programmed to shock-only mode. Participants assigned to amiodarone or matching placebo began therapy as outpatients immediately after randomization. Placebo and amiodarone were administered as a loading dose of 800 mg/day for one week, 400 mg/day for three weeks, and then as a daily maintenance dosage according to weight and bradycardia status. Participants assigned to ICD therapy received their device a median of three days after randomization. The goal of ICD therapy was to treat only rapid, sustained ventricular tachycardia or ventricular fibrillation. Dual-chamber or biventricular devices, or antitachycardia or rate-response pacing therapies were not permitted. The ICD was uniformly programmed to have a detection rate of 187 beats per minute or more. Antibradycardia pacing was initiated only if the intrinsic rate decreased to less than 34 beats per minute. Median follow-up was 45.5 months. The primary end point was death from any cause. Secondary outcome measures included cardiac mortality, arrhythmic mortality, morbidity, quality of life, and incremental cost-effectiveness of the interventions. Each active treatment arm was compared to the placebo drug arm. Conclusions In participants with NYHA class II or III CHF and LVEF of 35% or less, amiodarone had no favorable effect on survival, whereas single-lead, shock-only ICD therapy reduced overall mortality by 23%.

  Study phs003654

• Best Endovascular vs. Best Surgical Therapy in Patients With Critical Limb Ischemia (BEST CLI-BioLINCC)

  Data Access NOTE Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives To compare the effectiveness of surgical treatment to the effectiveness of endovascular treatment in adults with chronic limb-threatening ischemia who are eligible for both treatment options. Background Peripheral artery disease (PAD) affects more than 200 million people worldwide. A portion of those individuals develop chronic limb-threatening ischemia (CLTI). CLTI is associated with severe health outcomes. CLTI is defined by ischemic foot pain at rest, ischemic ulcerations, or gangrene. Treatment for CLTI includes revascularization to improve limb perfusion and limit the risk of amputation. However, the choice of surgery or endovascular therapy for revascularization varies greatly. The extent to which this variability affects clinical outcomes in patients with CLTI is unknown. The BEST-CLI trial was initiated to determine whether endovascular revascularization was superior to surgical revascularization in patients with CLTI. Participants A total of 1434 participants with a single segment of great saphenous vein comprised cohort 1. Of these, 718 participants were randomly assigned to the surgical treatment group and 716 participants were randomly assigned to the endovascular therapy group. A total of 396 participants needing an alternative conduit comprised cohort 2. Of these, 197 participants were randomly assigned to the surgical treatment group and 199 participants were randomly assigned to the endovascular therapy group. Design BEST-CLI was an international, randomized, open-label trial. Participants were assigned to one of two cohorts based on the availability of a single segment of great saphenous vein. Participants in both cohorts were randomly assigned to either surgery or endovascular therapy. Follow-up was performed at 30 days after the procedure, 3 months, 6 months, and every 6 months thereafter up to 84 months after randomization. Telephone visits in lieu of clinic visits were planned at 30 months and every 12 months thereafter and at the end of the trial. Participants were followed for major adverse cardiovascular events (myocardial infarction, stroke, or death from any cause), quality of life, level of pain, and performance on the six-minute walk test. The primary outcome was a composite of major adverse limb events or death from any cause. A major adverse limb event was defined as above ankle amputation of the index limb or a major index-limb reintervention (new bypass, interposition graft revision, thrombectomy, or thrombolysis). Conclusions Among patients with CLTI who had an adequate great saphenous vein for surgical revascularization (cohort 1), the incidence of a major adverse limb event or death was significantly lower in the surgical group than in the endovascular group. Among the patients who lacked an adequate saphenous vein conduit (cohort 2), the outcomes in the two groups were similar. Farber A, Menard MT, Conte MS, et al. Surgery or Endovascular Therapy for Chronic Limb-Threatening Ischemia. N Engl J Med. 2022;387(25):2305-2316. PMID 36342173

  Study phs003844