10648 results for "fc coins olx Navštivte Buyfc26coins.com Podpora pro profesionální hráče a týmy..zSiZ"

in 38.57 milliseconds.

• Whole_genome_sequencing_of_a_Grem1_mutant_human_tumour

  The BMP antagonist Grem1 has been shown to be associated with a rare human polyposissyndrome (HMPS). We have shown that there is a 40KB duplication on chrom 15 found insome patients with HMPS. Traditional serrated adenomas (rare sporadic polyps) share somemorphological features with HMPS polyps and it has long been hypothesised that they are thesporadic version of HMPS polyps. We have obtained of one of theselesions and in this project we aim to characterise this tumour.

  Study EGAS00001000562

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Much ado about nothing? - Off-target amplification can lead to false positive bacterial brain microbiome detection in healthy and Parkinson's disease individuals

  Recent studies suggested the existence of (poly-)microbial infections in human brains. Using 16S rRNA gene amplicon sequencing, we tested the hypothesis that there is a bacterial brain microbiome. We evaluated brain samples from healthy human subjects and individuals suffering from PD (olfactory bulb and pre-frontal cortex). We identified off-target amplification as a major confounding factor in low-bacterial/high-host-DNA scenarios.

  Study EGAS00001004757

• Spatial Heterogeneity in CLL

  A whole-genome/exome sequencing (WGS/WES) characterization of the spatial heterogeneity found in chronic lymphocytic leukemia (CLL) at diagnosis. Fifteen synchronous peripheral blood and lymph node samples were analyzed by WGS (n=2) or WES (n=13). Subtle differences in the global architecture of the tumor at peripheral blood and lymph node were observed only in a fraction of patients. Spatial heterogeneity was not found among the well-established CLL driver alterations.

  Study EGAS00001003803

• Distinct genomic profile and specific targeted drug responses in adult cerebellar glioblastoma

  Only a few studies have reported the molecular characteristics of adult cerebellar glioblastoma (C-GBM), a subtype comprising 1% of glioblastoma cases located within the infratentorial brain region due to the rarity. By identifying genomic profiles from 19 adult C-GBM samples, we revealed the genetic intertumoral heterogeneity in C-GBM as well as distinct genomic characteristics from those of supratentorial glioblastomas (S-GBMs), emphasizing the need of individualized therapies for C-GBM patients.

  Study EGAS00001002517

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Whole-exome sequencing of ovarian clear cell carcinoma in clinical outliers

  Whole-exome sequencing dataset for the Australian Ovarian Cancer Study (AOCS) and The Jikei University School of Medicine (JIKEI) ovarian clear cell carcinoma (OCCC) clinical outliers project, representing 10 donors. Although OCCC are commonly resistant to platinum based chemotherapy, good clinical outcomes are observed in a subset of patients. Exome sequencing was performed in 10 patients who had either unusually long survival (N=5) or had a very short time to progression (N=5).

  Study EGAS00001004248

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Nasal epithelial cells of PCD and non-PCD patients grown at air-liquid interface for RNAseq analysis

  Raw RNAseq data files of genetically unsolved PCD patients used for transcriptomic analysis aming to uplift the diagnostic rate. The non-PCD patients were used as a clinical comparator to the PCD patients. Majority of the nasal epithelial cells used for RNAseq were cultured at an air-liquid interface for 21 days, unless the data file name indicates a different air-liquid-culture time-point.

  Study EGAS00001006632

• Somatic mutation and clonal evolution in premalignant lung disease - WGS (2020-01-15)

  Cancer is a genetic disease caused by an accumulations of mutations, however many of these mutations have been identified in pathologically normal tissue. We aim to use laser-capture microscopy (LCM) to sample individual clones from the lung tissue of individuals with a variety of lung diseases (COPD, UIP, IPF, Emphysema, pulmonary hypertension). This will allow us to identify whether cancer-associated mutations appear in this normal tissue, assess the mutational burden present, and identify the mutational processes causing these mutations. Smoking is a large risk factor for developing many of these lung diseases so we are particularly keen to determining whether there is evidence of a smoking signature in these patients. . This dataset contains all the data available for this study on 2020-01-15.

  Dataset EGAD00001005786

• Evaluating gene expression in aggressive B-cell lymphoma using a quantitative nuclease protection assay

  Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma (NHL), comprising 25-30% of all NHL in developed countries with an annual incidence in the USA of 7 cases/100000 persons/year. Collectively, DLBCL is classified based on a common morphological appearance of diffuse growth of large transformed B-cells, immunophenotype, high proliferation rate and aggressive behaviour. Despite these similarities, DLBCLs are a heterogeneous collection of malignancies with distinct clinical and molecular characteristics that do not always correlate with immunohistological features. This gene expression dataset includes transcriptomes of ABC-DLBCLs and of GCB-DLBCLs where cell of origin is determined by the HTG-EdgeSeq quantitative nuclease protection assay. Also included are clonality results from BCR profiling from high-grade B-cell lymphomas sequenced using a NOVA sequencer

  Dataset EGAD00001011309

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• Organ maturation in preparation for birth (Peds RFA) to develop a tissue resource and a single-cell atlas of organ development and maturation for dissemination among the scientific and clinical community: RNA (2025-10-14)

  Knowledge about abnormal organ development is important to understand pathology and to develop novel treatment approaches for individuals with congenital and acquired disease. Most of our current understanding is based on examination of tissues from the embryo and early foetus, collected from women undergoing termination of pregnancy in the first trimester (third) of pregnancy. There is very little known about normal and abnormal organ development from a developmental perspective during the crucial last two-thirds of pregnancy when much remodelling of foetal tissues occurs. This study will generate a single-cell atlas of late-foetal lungs, blood, heart, bone and immune organs. . This dataset contains all the data available for this study on 2025-10-14.

  Dataset EGAD00001015737

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria (2018-03-14)

  Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria. There are more than 100 genes known for congenital disorders of glycosylation and new disorders are discovered each year. WE included patients with a so far unsolved glycosylation disease. The diagnostic group 3-methyglutaconic aciduria is a heterogenous group of disorders mostly caused by abnormal phospholipid synthesis or in association with mitochondrial dysfunction. We included patients with a so far unsolved disease and 3-methylglutaconic aciduria. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ . This dataset contains all the data available for this study on 2018-03-14.

  Dataset EGAD00001004038

• Acquisition of additional mutations drives accelerated progression of NPM1 positive CMML to AML

  This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ We performed exome sequencing on serial samples from a patient with CMML who progressed to AML. The exome sequencing suggests that NPM1, TET2 and DNMT3a mutations were present in the dominant clone in the CMML sample and that NRAS is a new subclonal mutation in the AML sample. Diagnostic data shows the presence of a FLT3-ITD mutation in the AML sample, which is likely to have driven progression. Here we are performing re-sequencing of the putative driver and some passenger mutations which appear to be in the same clone to validate these mutations and to verify the relative quantification of these abnormalities .

  Dataset EGAD00001002194

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• Genetic scoring guide for personalized risk assessment in pediatric B-cell precursor Acute Lymphoblastic Leukemia

  In this study a next-generation sequencing based method was applied to comprehensively screen for recurrent, disease-relevant copy number aberrations in a cohort of Hungarian patients. Diagnostic bone marrow samples from 260 children with B-cell acute lymphoblastic leukemia and were investigated by digital multiplex ligation-dependent probe amplification using the disease-specific D007 probemix. Whole chromosome gains and losses, as well as subchromosomal copy number aberrations were simultaneously profiled.

  Study EGAS00001007239

• Clonal_selection_after_gene_therapy_in_SCD___Duplex_sequencing

  This study includes the targeted duplex sequencing data relating to this study. A custom targeted panel was used including 29 AML-associated genes, and a set of mutations from driver-containing clones that were sequenced during the WGS tree-building phase of the study. Targeted sequencing is performed on each of 6 individuals included at the study at at least 3 time points per individual: one prior to gene therapy, and two post-therapy time points.

  Study EGAS00001007253

• RNA sequencing in primary human macrophages overexpressing ETS2

  We investigated an intergenic haplotype on chr21q22, linked to five different inflammatory diseases, and discovered a mechanism that orchestrates macrophage responses during chronic inflammation. We delineated how the risk haplotype increases expression of the causal gene, ETS2, and demonstrated that ETS2 is necessary for inflammatory macrophage effector functions. To establish whether ETS2 is sufficient to drive inflammatory responses, we overexpressed ETS2 in a dose-dependent manner and performed RNA-sequencing to characterise the transcriptional effects.

  Study EGAS00001007554

• eMERGE Network Phase III Clinical Sequencing: eMERGEseq Panel

  The Electronic Medical Records and Genomics (eMERGE) Network is a National Institutes of Health (NIH)-organized and funded consortium of U.S. medical research institutions. The primary goal of the eMERGE Network is to develop, disseminate, and apply approaches to research that combine biorepositories with electronic medical record (EMR) systems for genomic discovery and genomic medicine implementation research. eMERGE was announced in September 2007 and began its third phase in September 2015. eMERGE III consists of nine study sites, two central sequencing and genotyping facilities, and a coordinating center. eMERGE Phase III aims to: 1) sequence and assess the phenotypic implication of rare variants in a custom designed eMERGEseq panel consisting of 109 genes (including 56 ACMG actionable finding list genes and the top 6 genes from each site relevant to their specific aims), as well as approximately 1400 SNPs; 2) assess the phenotypic implications of these variants by developing, validating and implementing new phenotype algorithms, 3) integrate genetic variants into EMRs to inform clinical care; and 4) create community resources. Included in this study are: ~24,000 eMERGE participants from 10 eMERGE III study sites. Corresponding demographics, body mass index measurements. Top PheWAS codes generated from a collated list of ICD codes from all study sites. Study sites and participants include: Cincinnati Children's Hospital Medical Center (CCHMC): Cincinnati Children's Hospital Medical Center (CCHMC) is a not-for-profit hospital and research center pioneering breakthrough treatments, providing outstanding family-centered patient care and training healthcare professionals for the future, and dedicated to improving health and welfare of children and to the shared purpose of discovery and practical application of new genomic information to the ordinary care of children. We bring a comprehensive electronic health record (EPIC), a deidentified i2b2 data warehouse of 680K patient records, a biobank with >261,000 consents that allow return of results to >84,000 patients and guardians who have provided DNA samples, and hundreds of faculty and senior staff who make genomics or informatics an active focus of their research. CCHMC will help the eMERGE III Steering Committee identify genes for the eMERGE III targeted sequencing panel, provide 3,000 DNA samples from CCHMC patients to be sequenced, review targeted gene panels from clinical care at CCHMC for somatic mosaicism and reinterpretation, and further develop and disseminate a software workflow suite for sequence analysis. We will also extend our work generating phenotype algorithms using heuristic and machine learning methods to many new childhood diseases. We will develop tools to evaluate adolescent return of results preferences, examine the ethical and legal obligations and potential to reanalyze results, and develop clinical decision support for phenotyping, test ordering, and returning sequencing results. Children's Hospital of Philadelphia (CHOP): The Center for Applied Genomics (CAG) is a specialized Center of Emphasis at the Children's Hospital of Philadelphia (CHOP), and one of the world's largest genetics research programs, with to state-of-the-art high-throughput sequencing and genotyping technology. Our primary goal is to translate basic research findings to medical innovations. We aim to develop new and better ways to diagnose and treat children affected by rare and complex medical disorders, including asthma, autism, epilepsy, pediatric cancer, learning disabilities, and a range of rare diseases. Ultimately, our objective is to generate new diagnostic tests and to guide physicians to the most appropriate therapies. Participants were recruited from the CAG biorepository (n>450,000), specifically from >100,000 CHOP pediatric patients and family members, which is enriched for rare-diseases (n>12,000). Center for Applied Genomics, The Children's Hospital of Philadelphia We gratefully thank all the children and their families who enrolled in this study, and all individuals who donated blood samples for research purposes. Genotyping for this project was performed at the Center for Applied Genomics and supported by an Institutional Development Award from The Children's Hospital of Philadelphia. Sequencing was supported by the National Institutes of Health through an award from the National Human Genome Research Institute's Electronic Medical Records and Genomics (eMERGE) program (U01HG008684). Columbia University: The goal of the Columbia eMERGE III project is to develop methods for integrating genomic data in EHRs and to study the impact of such genomic informatics interventions on the health of a diverse, underserved urban adult English- and Spanish-speaking patient population in Northern Manhattan served by Columbia University Medical Center/New York-Presbyterian Hospital system. The study group is 2500 patients recruited from diverse clinics and community outreach centers of self-reported White (~61%), Asian (~11%), African-American (~11%), American Indian/Alaska Native (<1%) racial and Hispanic (~33%) ethnic backgrounds. There are two subgroups in the study cohort - a retrospective group (N=1052) that includes patients from oncology and nephrology clinics, and a prospective one (N=1448) that includes healthy individuals as well as participants with diverse medical conditions. Confirmed pathogenic variants in 70 selected genes will be returned to participants and their healthcare providers through the EHR integration. Participants are able to choose the results they receive and will have the freedom to meet with a genetic counselor and a geneticist to review results. The impact of genetic testing on clinical care is determined by periodic monitoring of EHRs. Geisinger: Samples and phenotype data in this study were provided by the Geisinger MyCode® Community Health Initiative. Participants are recruited across the Geisinger System via online consents or in-person consents at a hospital or clinic visit. Enrollment is ongoing with over 100,000 individuals currently consented. Partners Healthcare (Harvard University): The Partners HealthCare Biobank is a large research program designed to help researchers understand how people's health is affected by their genes, lifestyle, and environment. This large research data and sample repository provides access to high-quality, consented blood samples to help foster research, advance our understanding of the causes of common diseases, and advance the practice of medicine. For the Partners research community (Massachusetts General Hospital and Brigham and Women's Hospital), the Biobank provides: Banked samples (plasma, serum, and DNA) collected from consented patients Blood samples that were discarded after clinical testing in the Crimson Cores maintained in the Brigham and Women's Hospital and Massachusetts General Hospital Pathology Departments Sample handling and preparation services Link to the biobank data to the Partners Research Patient Data Registry (RPDR) a research instance of our electronic clinical chart Data access through our research portal. To date, over 70,000 Partners patients have given their consent to enroll, give a blood sample, receive research results and agreed to be re-contacted for additional research studies. The Biobank has enabled Partners investigators to compete for nationally recognized grants in personalized medicine such as a clinical electronic Medical Records and Genomics network (eMERGE) site and the national All of US program. The Biobank currently supports over 120 Partners investigators and over 130 million dollars in NIH research. Kaiser Permanente Washington/ (KPWA) / University of Washington (UW): KPWA participants were enrolled in the eMERGE Network through the Northwest Institute of Genetic Medicine (NWIGM) biorepository, and provided the appropriate consent to receive clinically relevant genetic results (N=2,500.) NWIGM is based at the University of Washington and co-managed by the University of Washington and KPWA. The purpose of the NWIGM biorepository is to build infrastructure and resources to carry out a broad range of future genetic research. KPWA members enrolled in the biorepository are asked to provide informed consent to providing a DNA sample for storage in the NWIGM biorepository. The consent is purposefully broad to serve the dual purpose of reducing the burden on researchers who wish to use this biorepository and the IRB committees who will be responsible for reviewing these requests in the future. Participants were eligible if aged 50 - 65 years old at the time of their enrollment into the NWIGM repository, living, enrolled in KPWA's integrated group practice, and had completed an online Health Risk Appraisal. The selection algorithm was based on several data sources from the EHR at KPWA. 1) Demographics - participants with self-reported race as Asian ancestry were prioritized and selected to enrich for non-European ancestry. The KPWA eMERGE cohort includes N=1,245 members of Asian ancestry. 2) Participants were also selected for a history of colorectal cancer (N=1,255), in order to allow us to enrich germline pathogenic variants. Mayo Clinic: The Return of Actionable Variants Empirical (RAVE) Study was approved by the Mayo Clinic IRB. We recruited 2537 participants from Mayo Clinic biobanks in Rochester, MN, who had hypercholesterolemia or colon polyps, thereby enriching for Familial hypercholesterolemia (FH) and monogenic causes of colorectal cancer (CRC). Additional eligibility criteria were: 1) residents of Southeast MN who were alive and aged 18-70 years; 2) LDL-C level >155 or >120 mg/dl while on lipid-lowering therapy; 3) no known cause of secondary hyperlipidemia; and 4) no cognitive impairment or dementia that would compromise their ability to give written informed consent. Based on these criteria, we identified 5270 eligible patients and obtained informed consent from 3030 participants. Recruitment was conducted in waves and utilized mailed recruitment packets consisting of a study brochure, a written informed consent form, a baseline psychosocial questionnaire, and a return postage-paid envelope. DNA of 2537 participants was sent for CLIA-certified targeted sequencing of 109 genes including genes associated with FH and CRC. Targeted sequencing and genotyping was performed in a Central Laboratory Improvement Amendment (CLIA)-certified laboratory. Northwestern University: Samples and data used in this study were obtained from patients from Northwestern Medicine, an integrated healthcare system, formed through a partnership of Northwestern Memorial HealthCare and Northwestern University Feinberg School of Medicine. Participants include a retrospective cohort from the Northwestern Pharmacogenomics Study, funded through the eMERGE II project, NHGRI (3U01HG006388-02S1) and a prospective cohort from the Genetic Testing and Your Health Study, funded through the eMERGE III project, NHGRI (U01HG008673). Patients were eligible to participate if they were18 years or older and see a physician at Northwestern Medicine. Patients consented to genetic testing and to allow their results to be placed in their electronic medical record. Vanderbilt University Medical Center: Vanderbilt University Medical Center (VUMC) participants were enrolled in the eMERGE Network through the Vanderbilt Genome-Electronic Records (VGER) project. Patients were provided the appropriate consent to receive clinically relevant genetic results (N=2,700). Participants were eligible if aged 21 or over, had a healthcare provider at VUMC, and visited the provider at least 3 times in the past 3 years. Meharry Medical College: Inclusion of ethnic groups in genomic research is critical to identify possible reasons for health disparities. African-Americans are being enrolled in various outpatient clinics of Nashville General Hospital at Meharry, an inner city hospital primary serving a poorer patient group. A total of 500 African Americans with four cancer types demonstrating health disparities in this population - prostate, colon, breast, lung are identified and approached by clinical research coordinators. The purpose of the study is to determine if any genetic information can be identified from these patients who have or are at high risk of one of these disparate cancers. All participants provide written informed consent and HIPAA authorization to provide blood samples for broad research use and permission to access data in their hospital electronic medical record for research now and in the future. An extensive demographic profile is obtained and entered into a REDCap database. Blood samples are obtained for a panel of alleles from extracted DNA at Baylor. In addition, de-identified coded samples are processed and stored in a central biorepository for further DNA, RNA and proteomic analyses. The survey and phlebotomy are performed at the time of the initial contact and agreement to participate. Nearly all patients approached willingly agree to participate for potential benefit to themselves, family members, or humankind. Little concern is voiced of providing samples for genetic analysis. Study investigators will share results with the participants and providers if testing does not indicate high risk. Results indicating increased risk or actionable alleles for the patient and/or family will be returned by a genetic counselor. Monitoring of the patients' health in this cohort will continue to be followed in the EMR to identify any future associations that might explain health disparities in African Americans. Proposals will be reviewed from investigators to study the genetic or proteomic samples as well as the clinical and demographic information in the repository. Please note that this version of the dataset has a handful of mismatches between genotyped and provided sex. Data with the following IDs should be removed prior to analysis: 420252874213744142412243424569384245694642672223

  Study phs001616

• Germ Cell and Associated Heme Malignancies Evolve from a Common Shared Precursor

  Germ cell tumors (GCTs) are the most common cancer in men between the ages of 15-40. While most patients are cured, those with disease arising in the mediastinum have distinctly poor outcomes. One in every 17 patients with primary mediastinal non-seminomatous GCTs develop an incurable hematologic malignancy and prior data intriguingly suggests a clonal relationship exists between hematologic malignancies and GCTs in these cases. To date however, the precise clonal relationship between GCTs and the diverse additional somatic malignancies arising in such individuals has not been determined. Here, we traced the clonal evolution and characterized the genetic features of each neoplasm from a cohort of fifteen patients with GCTs and associated hematologic malignancies. We discovered that GCTs and hematologic malignancies developing in such individuals evolved from a common shared precursor, nearly all of which harbored allelically imbalanced TP53 and/or RAS pathway mutations. Hematologic malignancies arising in this setting genetically resembled mediastinal GCTs rather than de novo myeloid neoplasms. Our findings argue that this scenario represents a unique clinical syndrome, distinct from de novo GCTs or hematologic malignancies, initiated by an ancestral precursor which gives rise to the parallel evolution of GCTs and blood cancers in these patients. Reprinted from PMID: 32897884, with permission from JCI.

  Study phs002231

• A Large Data Resource of Genomic Copy Number Variation across Neurodevelopmental Disorders

  This study presents the first genome-wide copy number variation (CNV) analysis across autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD), schizophrenia (SCZ), and obsessive-compulsive disorder (OCD). A total of 2,691 subjects diagnosed with a neurodevelopmental disorder (NDD), and a total of 1,769 unaffected family members from Ontario, Canada were assayed using the Affymetrix CytoScan HD array. We identified rare CNVs, (< 0.1% frequency in 10,851 population control samples), and found clinically relevant CNVs in 10.5% of total subjects. Among all NDD subjects, we identified 17 (0.63%) with aneuploidies and 115 (4.3%) with known genomic disorder variants. We searched further for genes impacted by different CNVs in multiple disorders. Examples of NDD-associated genes linked across more than one disorder (listed in order of occurrence) are NRXN1, SEH1L, LDLRAD4, GNAL, GNG13, MKRN1, DCTN2, KNDC1, PCMTD2, KIF5A, SYNM, and long non-coding RNAs: AK127244, NRON, and PTCHD1-AS. We demonstrated that identical CNVs or genes could potentially contribute to the etiology of multiple NDDs. The CNVs identified will serve as a useful resource for both research and diagnostic laboratories for prioritization of variants and clinical interpretations.CNV data from this study are available through dbVar at https://www.ncbi.nlm.nih.gov/dbvar/studies/nstd173/.

  Study phs001881

• Rapid Evolution of a Skin Lightening Allele in Southern African KhoeSan

  The genetic architecture and polygenicity of skin pigmentation is explored in KhoeSan communities, including Nama individuals whose phenotype and genotype data are provided in this dataset. By pairing genotypes and quantitative spectrophotometric skin pigmentation phenotypes, we show that skin pigmentation is highly heritable in KhoeSan, yet known pigmentation loci only explains a small fraction of the phenotypic variance. Using genome-wide association analyses, we identified both canonical and non-canonical skin pigmentation loci. We show that this phenotype is more polygenic and complex than previously characterized. (Martin et al., Cell 2017. PMID: 29195075) Following up on the top associated signal with large effect size in the gene SLC24A5, we demonstrate that the canonical Eurasian nonsynonymous allele was introduced into KhoeSan via a recent migration ~2 kya and was under extremely strong selection. The derived allele was present at high frequency despite controlling for gene flow. With high-throughput sequences in the captured SLC24A5 region, we show that the most common derived haplotype is identical amongst Europeans, eastern African and KhoeSan. Using 4-population demographic simulations with selection, we show that the allele was introduced into the KhoeSan only 2,000 ya via a back-to-Africa migration and then experienced a selective sweep.

  Study phs001753

• Generation of a Cellular Atlas of Human Adipose Tissue

  White adipose tissue (WAT), once regarded as morphologically and functionally bland, is now recognized to be dynamic, plastic, heterogenous, and involved in a wide array of biological processes including energy homeostasis, glucose and lipid handling, blood pressure control, and host defense.  High fat feeding and other metabolic stressors cause dramatic changes in adipose morphology, physiology, and cellular composition, and alterations in adiposity are associated with insulin resistance, dyslipidemia, and Type 2 diabetes (T2D). Here we provide detailed cellular atlases of human and murine subcutaneous and visceral white fat at single-cell resolution across a range of body weight. We identify subpopulations of adipocytes, adipose stem and progenitor cells (ASPCs), vascular, and immune cells and demonstrate commonalities and differences across species and dietary conditions. We link specific cell types to increased risk of metabolic disease, and we provide an initial blueprint for a comprehensive set of interactions between individual cell types in the adipose niche in leanness and obesity. We also utilize bulk RNA sequencing data of enzymatically digested human adipocytes to scale these findings to a larger cohort. These data comprise an extensive resource for the exploration of genes, traits, and cell types in the function of WAT across species, depots, and nutritional conditions. 

  Study phs002766

• Assessing gene expression profiling from FFPE Patient Samples: A Comparison of Two Library Preparation Approaches and Recommendations

  Next-Generation Sequencing (NGS) has transformed cancer research and clinical practice, with Whole Exome Sequencing (WES) driving advances in mutational profiling and personalized oncology. Yet, transcriptomic signatures remain essential for understanding disease mechanisms, including therapy resistance pathways. RNA sequencing (RNA-seq), however, faces unique challenges when dealing with low-input or degraded RNA, as often found in archival formalin-fixed paraffin-embedded (FFPE) tissues. Although previous studies have compared library preparation protocols, rapidly evolving technologies call for updated evaluations. Here, we present a direct comparison of two FFPE-compatible stranded RNA-seq library preparation kits: TaKaRa™ SMARTer® Stranded Total RNA-Seq Kit v2 (Kit A) and Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Kit B). Both kits generated high-quality RNA-seq data, yet important differences emerged. Notably, Kit A achieved comparable gene expression quantification to Kit B while requiring 20-fold less RNA input, a crucial advantage for limited samples, albeit with increased sequencing depth. We critically discuss these results in relation to RNA availability, technical performance, cost-effectiveness, processing time, and automation potential, offering practical guidance for selecting optimal RNA-seq strategies in clinical and translational research settings

  Study EGAS50000001066

• Recurrent somatic JAK-STAT mutations within a novel RUNX1-mutated pedigree

  The acquisition of somatic mutations is an emerging field of investigation in familial leukemia. Currently, genetic profiles in familial MDS/AML are considered analogous to sporadic disease, although the patterns of clonal evolution within families are poorly defined. We performed whole exome profiling of tumour samples from a novel RUNX1 mutated family, to determine the stepwise evolution of MDS/AML across 4 young siblings. Three siblings developed monocytic AML/RAEB2 at 5 years of age, with hepatosplenomegaly and somatic mutations upregulating JAK-STAT signalling, the latter are typically detected in <5% of sporadic MDS/AML. Two siblings acquired the canonical JAK2 V617F mutation, while another acquired a unique missense mutation of SH2B3, a negative regulator of JAK2. Notably, 2/3 siblings demonstrated dosage amplification of these mutations due to acquired uniparental disomy of chromosomes 9p and 12q (encompassing JAK2 and SH2B3, respectively). All 4 siblings were heterozygous for the 46/1 JAK2 haplotype associated with predisposition to sporadic V617F myeloproliferative disorders, which likely influenced the acquisition of JAK2 mutations. Our findings provide further evidence that relatives with shared germline mutations may acquire somatic mutations in a non-random manner leading to convergent patterns of disease evolution.

  Study EGAS00001001862

• Hermansky-Pudlak syndrome type 1 causes impaired anti-microbial immunity through a pathogenic lipid metabolism-mTOR circuit

  Mendelian diseases that present with immune-mediated disorders can provide insights into the molecular mechanisms that drive inflammation. Hermansky-Pudlak syndrome (HPS) types 1 and 4 are caused by defective vesicle trafficking involving the BLOC-3 complex. The presence of inflammatory complications such as Crohn’s disease-like inflammation and lung fibrosis in these patients remains enigmatic. Using mass cytometry we observe an augmented inflammatory monocyte compartment in HPS1 patient peripheral blood that may be associated with a TNF - and IL-1α-dominated cytokine dysregulation. HPS1 patient monocyte-derived macrophages express an inflammatory TNF-OSM mRNA gene signature and changes in lipid metabolism. Using stimulation experiments and lysosomal proteomics we show that defective lipid metabolism drives RAB32-dependent mTOR signaling, facilitated by the accumulation of mTOR on lysosomes. This pathogenic circuit translates into aberrant bacterial clearance, which can be rescued with mTORC1 inhibition. We reveal that a pathogenic lipid-mTOR signaling circuit acts as a metabolic checkpoint for defective anti-microbial activity. This mechanism may be relevant to the complex pathology of HPS1 patients featuring macrophage lipid accumulation, granuloma formation, defective anti-microbial activity and tissue inflammation. Lastly, this circuit may be present in a wider group of disorders with defective lipid metabolism and cholesterol accumulation.

  Study EGAS00001005053

• Hermansky-Pudlak syndrome type 1 causes impaired anti-microbial immunity through a pathogenic lipid metabolism-mTOR circuit - 10x Genomics scRNAseq

  Mendelian diseases that present with immune-mediated disorders can provide insights into the molecular mechanisms that drive inflammation. Hermansky-Pudlak syndrome (HPS) types 1 and 4 are caused by defective vesicle trafficking involving the BLOC-3 complex. The presence of inflammatory complications such as Crohn’s disease-like inflammation and lung fibrosis in these patients remains enigmatic. Using mass cytometry we observe an augmented inflammatory monocyte compartment in HPS1 patient peripheral blood that may be associated with a TNF - and IL-1α-dominated cytokine dysregulation. HPS1 patient monocyte-derived macrophages express an inflammatory TNF-OSM mRNA gene signature and changes in lipid metabolism. Using stimulation experiments and lysosomal proteomics we show that defective lipid metabolism drives RAB32-dependent mTOR signaling, facilitated by the accumulation of mTOR on lysosomes. This pathogenic circuit translates into aberrant bacterial clearance, which can be rescued with mTORC1 inhibition. We reveal that a pathogenic lipid-mTOR signaling circuit acts as a metabolic checkpoint for defective anti-microbial activity. This mechanism may be relevant to the complex pathology of HPS1 patients featuring macrophage lipid accumulation, granuloma formation, defective anti-microbial activity and tissue inflammation. Lastly, this circuit may be present in a wider group of disorders with defective lipid metabolism and cholesterol accumulation.

  Study EGAS00001005098

• Comprehensive Genomic Characterization of Refractory Multiple Myeloma Reveals a Complex Mutational and Structural Landscape Associated with Drug Resistance (H067)

  Outcome of patients with multiple myeloma (MM) refractory to immunomodulatory agents (IMiDs) and proteasome inhibitors (PIs) is still very poor. To elucidate the genetic landscape of relapsed/refractory MM (RRMM) we performed whole genome and transcriptome sequencing of 39 heavily pretreated RRMM patients with at least double refractoriness revealing complex structural changes and a high mutational load (H067/K08K). We found a median of 67 structural variants and 116 nonsynonymous exonic mutations per patient. Assessment of oncogenic drivers showed NRAS, BRAF, TP53, KRAS, SLC4A7, FAM46C, DIS3, RB1, KMT2C, MLLT4, EWSR1, HCFC2, and COPS3 as significantly mutated. We found multiple genomic regions with bi-allelic events affecting known tumor suppressor genes, most frequently TP53, RB1, and TRAF3. Supervised analysis of mutational signatures showed a major contribution of Cosmic signature 6 associated with deficiency in DNA mismatch repair and the ‘BRCAness’ signature which coincided with mutations in genes known to confer PARP inhibitor sensitivity. Recurrently mutated gene networks included genes with relevance for PI and IMiD activity, the latter including in particular members of the Cereblon and the COP9 signalosome complex. In conclusion, this comprehensive genomic characterization revealed a complex mutational and structural landscape in RRMM and highlights potential implications for therapeutic strategies.

  Study EGAS00001004363

• tFL with a PMBL GE signature

  We investigated the clinicopathologic features of 5 follicular lymphomas (FL) that transformed to morphologic diffuse large B-cell lymphomas (DLBCL) and had a primary mediastinal large B-cell lymphoma (PMBL)-like gene expression profile. None of the transformed FL (tFL) arose in the mediastinum, all cases tested had a germinal center B-cell immunophenotype, 20% were CD30+, 60% CD23+, 80% MAL+, 20% CD200+, and 0% CD273/PDL2+. Whole exome sequencing detected alterations in genes associated with both FL/DLBCL (CREBBP, KMT2C, KMT2D, ARID1A, HIST1 members, and TNFRSF14) and PMBL (JAK-STAT pathway genes, B2M, and CD58). Copy number (CN) analysis detected gains/amplification of REL in 60% and STAT6 in 40%, gains of chromosome 16, including IL4R, in 40%, and both deletions and gains of 11q in 20%. This cohort, although limited in size, supports a subset of tFL that has blended features between FL/DLBCL and PMBL. Despite having some features that are less common in DLBCL (MAL and CD23 expression, JAK-STAT activation), these cases lack the most characteristic CN alteration seen in PMBL (9p24.1 gain/amplification). This cohort expands the biologic heterogeneity of tFL, illustrating a subset with blended FL/DLBCL and PMBL features, with potential treatment implications that include the use of novel PMBL-targeted therapies.

  Study EGAS00001005870

• Asian Indian Diabetic Heart Study (AIDHS) /Sikh Diabetes Study (SDS)

  The Punjabi Sikh population is a well-defined, carefully collected homogeneous sample from northern India and the US. It has unique characteristics, which are ideal for genetic studies. Sikhs are strictly a non-smoking population and about 50% of participants are life-long vegetarians. All subjects included in the genome-wide association studies (GWAS) were recruited from one geographical location. Our population demonstrates a strong familial clustering of type 2 diabetes and related cardio-metabolic disorders that may be genetic and we believe that the contribution of alleles at specific loci are likely to be unique to Punjabi Asians compared to Europeans. Our group first showed that the association of a common variant at rs9939609 in the FTO (fat mass and obesity) gene in South Asians was independent of BMI (PMID:18598350) in contrast to Europeans where the association of same variant with T2D is mediated through obesity (PMID:17434869). These findings were later confirmed in an independent sample of South Indians (PMID:19005641), Pakistanis (PMID:21294771), and even East and South Asians in a large meta-analyses study comprising 96,551 individuals (PMID: 22109280). Earlier reported association of MTNR1B with fasting glucose concentrations and type 2 diabetes in European GWAS could not be confirmed in our Sikh cohort. On the other hand, our study revealed, for the first time, a significant protective association of another less common variant in MTNR1B with fasting glucose levels that was modulated by obesity. Ours was the first report that suggested that the low CETP activity was associated with higher CAD risk (PMID:22143414) in South Asians and that the genetic effects are significantly modulated by environmental factors (alcohol consumption). Our recent GWAS on type 2 diabetes has identified a novel locus at chromosome 13q12 in the SGCG gene (p=1.82x10-8) associated with type 2 diabetes (PMID:23300278) in Punjabi Sikhs. From these findings, we are optimistic that our resource will provide new insights to gene functions in the diabetic pathway and better help researchers to understand and translate these insights to novel therapeutic treatment and early prevention to T2D that may be important beyond Indians.

  Study phs000583

• National Institute on Aging (NIA) SardiNIA Study

  Sardinia is the second largest island in the Mediterranean and constitutes a genetically isolated founder population. This population has aided in the identification of genes involved in several Mendelian disorders and is attractive for genetic studies due to its organization in long-established settlements that developed from an initial group of founder settlers (~1,000) thousands of years ago. The current study has recruited 6,148 Sardinians aged 14 and older, from a cluster of four towns in the Lanusei Valley in the Ogliastra region of the province of Nuoro. This sample corresponds to approximately 62% of the population eligible in the area for recruitment. Information collected during enrollment allowed the individuals to be organized into 711 complex pedigrees, each up to five generations deep, with an average kinship coefficient of 0.1628. All volunteers have been characterized for 98 quantitative traits. Traits include anthropomorphic measures, plasma and serum markers (including cholesterol and other markers of cardiovascular disease), and personality traits (using the five-factor model). The main goal of the study is to examine phenotypic similarities between relatives that yield information on the overall contributions of genes to trait variability. Data given here provide p-values for 98 traits studied in 1,412 individuals, based on genotyping with the Affymetrix 500K chip and imputed markers using the HapMap population as a reference (N=2,259,179). Sharing this genome assessment data at high level of resolution for a variety of quantitative traits will be useful for other groups to validate newly observed associations and to investigate possible pleiotropic effects. For ulterior information, and in particular for any individual genotype information, a formal request should be addressed to the Steering Committee, c/o David Schlessinger, Chief, Laboratory of Genetics, National Institute on Aging, National Institutes of Health, NIH Biomedical Research Center, 251 Bayview Blvd., Suite 100 Baltimore, MD 21224 USA and should include IRB approval of a detailed proposal, along with a signed statement guaranteeing that no attempt will be made to identify any individual participant.

  Study phs000338

• NHLBI GO-ESP: Heart Cohorts Exome Sequencing Project (Ischemic Stroke Genetic Study, ISGS)

  The NHLBI "Grand Opportunity" Exome Sequencing Project (GO-ESP), a signature project of the NHLBI Recovery Act investment, was designed to identify genetic variants in coding regions (exons) of the human genome (the "exome") that are associated with heart, lung and blood diseases. These and related diseases that are of high impact to public health and individuals from diverse racial and ethnic groups will be studied. These data may help researchers understand the causes of disease, contributing to better ways to prevent, diagnose, and treat diseases, as well as determine whether to tailor prevention and treatments to specific populations. This could lead to more effective treatments and reduce the likelihood of side effects. GO-ESP is comprised of five collaborative components: 3 cohort consortia - HeartGO, LungGO, and WHISP - and 2 sequencing centers - BroadGO and SeattleGO. The Ischemic Stroke Genetics Study (ISGS) is a study of newly onset cases (~600) with ischemic stroke (a stroke due to sudden interruption of blood flow to a part of the brain) compared with sex- and age-matched non-stroke participants. The study was conducted to determine the genes and their variants that contribute to an individual's risk of developing an ischemic stroke. The coordination of the recruitment and flow of the samples occurred at the Mayo Clinic, Jacksonville, FL, under the direction of James F. Meschia, MD. The University of Virginia (Stephen S. Rich, PhD) served as the analytic site for the genetic data. All GWAS data on ISGS participants have been deposited into dbGaP. As part of the NHLBI Exome Sequencing Project, DNA from a subset of ISGS participants will undergo exome sequencing. For the NHLBI ESP, a subset of 92 individuals with lacunar (small vessel) or atherosclerotic (large vessel) TOAST subtypes were selected from among all ISGS participants, excluding those individuals with TOAST subtypes of stroke of other etiology or of stroke with undetermined etiology. All 92 samples pass initial quality control metrics and 89 samples completed exome sequencing. A total of 75 participants with appropriate consent and variant calls had their genetic and phenotypic data deposited into dbGaP.

  Study phs000546

• Gabriella Miller Kids First (GMKF) Pediatric Research Program in Susceptibility to Ewing Sarcoma Based on Germline Risk and Familial History of Cancer

  Ewing sarcoma (EWS) is a deadly bone cancer that occurs in children and adolescents. Mounting evidence suggests that a genetic predisposition exists for this pediatric cancer, although the specific genetic contribution has yet to be identified. EWS has never been linked to a specific cancer predisposition syndrome, although several case reports have been published that describe siblings and cousins with EWS. Furthermore, neuroectodermal tumors appear to occur more commonly in families with EWS. The two consistent epidemiology findings in EWS include a very strong Caucasian predilection and increased rates of hernia in EWS patients and their family members. Finally, the role of genetic microsatellite repeats in EWS tumorigenesis has been recently described, and these GGAA microsatellites are polymorphic in repeat size and location across the genome. The study goals of this Kids First project include (1) To identify cancer predisposition genes in EWS trios increasing disease risk, (2) To identify genome-wide GGAA microsatellite repeats in EWS trios increasing disease risk, and (3) To identity de novo mutation and structural variant rates in EWS trios reflecting underlying DNA repair defects that increase disease risk. As part of the Kids First Common Fund initiative, this study proposal will further elucidate the genetic contribution to pediatric cancer development. Around 375 of these trios were selected for whole genome sequencing as part of the Gabriella Miller Kids First fund. The EWS trios have been collected as part of the Children's Oncology Group's AEPI10N5 Study ("Genetic Epidemiology of Ewing Sarcoma"), and each trio has associated phenotypic data including a detailed family history. We will interrogate the sequence data using our genomic analysis pipeline at the University of Utah and the Utah Science Technology and Research initiative's (USTAR) Center for Genetic Discovery. We will look for the genetic contribution to EWS and the sequence data with be shared in a repository designated by the Kids First Common Fund. The WGS of these ~375 EWS trios will help us to understand the genetic origins of a deadly childhood cancer and may lead to novel strategies for prevention and treatment.

  Study phs001228

• DNA-Sequencing of Baseline Plasma From the Phase III Alliance A031201 Trial

  Liquid biopsy assays tailored for metastatic castration-resistant prostate cancer (mCRPC) patients are needed to identify molecular alterations and predict survival in the context of androgen receptor (AR) inhibitors. We developed a novel plasma cell-free DNA (cfDNA) sequencing assay to detect circulating tumor DNA (ctDNA) and alterations in key mCRPC driver genes, and tested associations with clinical features and survival outcomes in a phase III trial. cfDNA was isolated from evaluable baseline plasma specimens of untreated mCRPC patients (n=790) enrolled in the Alliance A031201 randomized phase III trial (NCT01949337) prior to enzalutamide therapy with or without abiraterone acetate and prednisone. A customized targeted cfDNA sequencing assay was used to detect AR and non-AR alterations in mCRPC. For this, DNA-seq libraries were constructed from cfDNA using Takara ThruPLEX Tag-Seq or Plasma-Seq kits, and subjected to hybridization enrichment using a custom-designed Agilent SureSelect bait panel. Post-capture DNA-seq libraries were pooled and sequenced on an Illumina HiSeq 2500 using 2x150 bp settings. ctDNA positivity was defined as >20% ctDNA using an aneuploidy-based estimate derived from ichorCNA (Group 1) or a novel definition of ≤20% ctDNA, but with detection of any alteration in AR, or gain of MYC and/or MYCN (Group 2). cfDNA sequencing data was obtained from 776 patients. There were 480/776 (62%) ctDNA-positive patients, with 324 (42%) in Group 1 and an additional 156 (20%) in Group 2 with AR or MYC/MYCN alterations detected. ctDNA-positive patients in Groups 1 and 2 had similarly poor median overall survival (OS) of 25.4 months (95% CI: 21.8-29.0) and 29.7 months (95% CI: 27.3-35.5), respectively, as compared to ctDNA-negative patients who had a median OS of 49.1 months (95% CI: 42.3-53.5). Relative to ctDNA-negative patients, OS was inferior in ctDNA-positive patients in Group 1 (HR 2.3, 95% CI: 1.9-2.9, P AR inhibitors in a contemporary phase III trial.

  Study phs003325

• Automated machine-learning approach for next generation profiling of sequence alterations, mutation burden, microsatellite instability, and structural variants in human cancers

  Sequence and structural alterations together with tumor mutation burden (TMB) and microsatellite instability (MSI) have been identified as biomarkers for the determination of response to targeted and immune checkpoint inhibitor therapies. However, widespread clinical adoption of these biomarkers has historically been limited due to barriers such as evidence of clinical utility and reimbursement. We have developed 2.2 Mb targeted NGS system and an automated machine-learning analysis approach (PGDx elio™ tissue complete, ETC) that has been FDA cleared for examination of 500+ cancer-related genes and 68 mononucleotide repeats for identification of sequence and structural alterations, TMB, and MSI in solid cancers in a clinical setting. We designed and trained this approach using sequence data from 4,174 cancers and >124,000 in silico alterations and evaluated the methodology in >2,550 tumor or non-cancerous normal samples. Independent analyses of ETC sequence changes in 440 formalin fixed paraffin embedded (FFPE) tumor or cell line samples using MSK-IMPACT™, FoundationOne®, and ddPCR revealed a positive percent agreement (PPA) >97% with high sensitivity as low as 3% mutant allele fraction. We observed high concordance between panel-wide and whole-exome TMB for 307 pan-cancer FFPE tumors (Pearson r=0.95, p < 0.0001) using samples with ≥20% tumor cellularity. Comparison of the mutation context and repeat-based MSI approach in ETC with a multiplex MSI PCR assay in 223 samples revealed a PPA of 99% and negative predictive agreement (NPA) >99%. We confirmed the accuracy and precision of TMB and MSI measurements across three independent laboratories (CV of <5% and average PPA >99%, respectively). Finally, evaluation of amplifications and translocations against DNA and RNA-based approaches exhibited >98% NPA and PPA of 86% and 82% respectively. These results demonstrate high analytical performance for determination of sequence and structural changes, TMB, and MSI using a targeted NGS panel and provide a scalable and facile approach for evaluating these biomarkers in a clinical laboratory.

  Study EGAS00001005556

• Identifying transcriptional programs underlying anti-EGFR small molecule response and resistance with TraCe-seq

  Genetic and non-genetic heterogeneity within cancer cell populations represents a major challenge to anti-cancer therapies. We currently lack robust methods to determine how pre-existing and adaptive features affect cellular responses to therapies. Here, by conducting clonal fitness mapping and transcriptional characterization using expressed barcodes and single-cell RNA-sequencing, we have developed TraCe-seq, a method that captures at clonal resolution the origin, fate, and differential early adaptive transcriptional programs of cells in a complex population in response to distinct treatments. We used TraCe-seq to benchmark how next-generation dual EGFR inhibitors-degraders compare to standard EGFR kinase inhibitors in EGFR-mutant lung cancer cells. To QC the TraCe-seq strategy, single-cell RNA-seq libraries were generated from a variety of human cancer cell lines transduced with the TraCe-seq library to validate the TraCe-seq strategy. Specifically, 5 different cell lines (PC9, MCF-10A, MDA-MB-231, NCI-H358, and NCI-H1373) were each transduced with a unique TraCe-seq barcode. The transduced cells were selected with puromycin only, dissociated to single cell suspensions, and then mixed together. The complex mixture of the 5 cell lines was profiled by 10X scRNA-seq. Furthermore, transduced NCI-H1373 cells were sorted by FACS to enrich for the top 50% of eGFP positive cells, and sorted cells were cultured briefly and used to construct scRNA-seq libraries and profiled by 10x scRNA-seq. To carry out the full TraCe-seq experiment, ~600 PC9 cells carrying unique TraCe-seq barcodes were expanded over 12 doublings to establish the barcoded population. A subset of the barcoded PC9 population was used to generate scRNA-seq libraries and profiled by 10x scRNA-seq prior to treatment to establish a baseline transcription profile for each barcoded clone. The rest of the cells were then treated for four days with 1 µM erlotinib, 1 µM GNE-069, or 1 µM GNE-104 respectively. scRNA-seq libraries were then generated form the treated cells and profiled by 10x scRNA-seq.

  Study EGAS00001005405

• Institut Curie Neuroblastoma Whole Genome Sequencing Diagnosis Relapse

  Neuroblastoma, a clinically heterogeneous pediatric cancer, is characterized by distinct genomic profiles but few recurrent mutations. As neuroblastoma is expected to have high degree of genetic heterogeneity, study of neuroblastoma's clonal evolution with deep coverage whole-genome sequencing of diagnosis and relapse samples will lead to a better understanding of the molecular events associated with relapse. Samples were included in this study if sufficient DNA from constitutional, diagnosis and relapse tumors was available for WGS. Whole genome sequencing was performed on trios (constitutional, diagnose and relapse DNA) from eight patients using Illumina Hi-seq2500 leading to paired-ends (PE) 90x90 for 6 of them and 100x100 for two. Expected coverage for sample NB0175 100x100bp was 30X for tumor and constitutional samples. For the seven other patients expected coverage was 80X for tumor samples with PE 100x100, 100X in the other tumor samples and 50X for all constitutional samples (see table 1). Following alignment with BWA (Li et al., Oxford J, 2009 Jul) allowing up to 4% of mismatches, bam files were cleaned up according to the Genome Analysis Toolkit (GATK) recommendations (Van der Auwera et al., Current Protocols in Bioinformatics, 2013, picard-1.45, GenomeAnalysisTK-2.2-16). Variant calling was performed in parallel using 3 variant callers: GenomeAnalysisTK-2.2-16, Samtools-0.1.18 and MuTect-1.1.4 (McKenna et al., Genome Res, 2010; Li et al., Oxford J, 2009 Aug; Cibulskis et al., Nature, 2013). Annovar-v2012-10-23 with cosmic-v64 and dbsnp-v137 were used for the annotation and RefSeq for the structural annotation. For GATK and Samtools, single nucleotide variants (SNVs) with a quality under 30, a depth of coverage under 6 or with less than 2 reads supporting the variant were filter out. MuTect with parameters following GATK and Samtools thresholds have been used to filter our irrelevant variants. .SNVs within and around exons of coding genes overlapping splice sites.. Then,variants reported in more than 1% of the population in the 1000 genomes (1000gAprl_2012) or Exome Sequencing Project (ESP6500) have been discarded in order to filter polymorphisms. Finally, synonymous variants were filtered out. MuTect focuses on somatic by filtering with constitutional sample. Mpileup comparison between constitutional and somatic DNAs allowed us to focus also on tumor specific SNVs with GATK and Samtools. Finally, every SNV called by our pipeline and also supported in any constitutional samples were filtered our in order to prevent putative constitutional DNA coverage deficiency. Then we analyzed CNVs (copy number variants) with HMMcopy-v0.1.1 (Gavin et al., Genome Res, 2012) and control-FREEC-v6.7 (Boeva et al., Bioinformatics 2011) with a respective window of 2000bp and 1000 bp, and auto-correction of normal contamination of tumor samples for Control-FREEC. Finally we explored Structural variants (SVs) including deletions, inversions, tandem duplications and translocations using DELLY-v0.5.5 with standard parameters (Rausch et al., Oxford J, 2012). In tumors, at least 10 supporting reads were required to make a call and 5 supporting reads for the sample NB0175 with a coverage of only 40X (see table 2). To predict SVs in constitutional samples for subsequent somatic filtering, only 2 supporting reads were required in order not to miss one. To identify somatic events, all the SVs in each normal sample were first flanked by 500 bp in both directions and any SVs called in a tumor sample which was in the combined flanked regions of respective normal sample was removed (see graph 1). Deletions with more than 5 genes impacted or larger than 1Mb and inversions or tandem duplications covering more than 4 genes, were removed. We focused on exonic and splicing events for deletions, inversions, and tandem duplications. For translocation, we keep all SVs that occurred in intronic, exonic, 5'UTR, upstream or splicing regions. Bioinformatics detection of variations with Deep sequencing approach Once PE reads merged and adaptors trimmed by SeqPrep with default parameters, merged reads were aligned via the BWA (Li H. and Durbin R. 2009 PMID 19451168) allowing up to 1 differences in the 22-base-long seeds and reporting only unique alignments. Only reads having a mapping quality 20 or more have been further analysed. Variant calling software was not used, since we aimed to predict variations at low frequencies, observed in less than 1% of reads. Such variants require a custom approach. Using DepthOfCoverage functions of the Genome Analysis Toolkit (GATK) v2.13.2 (McKenna A, et al., 2010 Genome Research PMID: 20644199), we focused on high quality coverage of bases A, C, G and T at the targeted variant position. Depth of coverage of each base following a mapping quality higher than 20 and a base quality higher than 10 have been taken into account in order to focus only on high quality data. Aiming to determine the background level of variability at the studied regions, 10 control samples were included in the analysis. The same approach and filtering criteria have been applied as introduced above over the entire amplicons. In order to highlight variants, for each sample the frequencies of each bases at each amplicon position were then compared to those observed in the set of controls. Statistical analyses were performed with the R statistical software (http://www.R-project.org). Fisher’s exact two-sided tests with a Bonferroni correction were performed to compare percentages of bases between the data sets, i.e. for a given base between a case and the controls. Finally, significant variations were filtered-in once (i) a significant increase in the percentage of avariant base and (ii) a significant decrease in the percentage of it's reference base following our p.values criteria was observed (p.val < 0.05).

  Dataset EGAD00001001356

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349