10901 results for "fc coins olx Navštivte Buyfc26coins.com Podpora pro profesionální hráče a týmy..zSiZ"

in 19.32 milliseconds.

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Unrelated Donor Reduced Intensity Bone Marrow Transplant for Children with Severe Sickle Cell Disease (BMT CTN-0601-BioLINCC)

  ObjectivesThe primary objective is to determine event-free survival (EFS) at 1 year after unrelated donor (URD) hematopoietic stem cell transplantation (HCT) using bone marrow (BM) in patients with sickle cell disease (SCD).BackgroundSickle cell disease (SCD), also known as sickle cell anemia, is an inherited blood disease that can cause organ damage, stroke, and intense pain episodes. Children with sickle cell disease experience organ damage, impaired quality of life, and premature mortality. A blood stem cell transplant is a treatment option for someone with a severe form of the disease. Prior to undergoing a transplant, people typically receive a conditioning regimen of high doses of chemotherapy and other medications to prepare the body to accept the transplant. This type of conditioning regimen is known as a myeloablative conditioning regimen, but it can result in toxicities and sterility. A conditioning regimen that uses lower doses of chemotherapy and medications may be safer for transplant recipients. This type of regimen is known as reduced intensity conditioning (RIC) regimen. RIC has a more favorable toxicity profile but is associated with higher rates of graft rejection (GR), especially with graft sources such as umbilical cord blood This study evaluated the safety and effectiveness of blood stem cell transplants, using bone marrow from unrelated donors, in children with severe SCD who receive a RIC regimen prior to the transplant.SubjectsPatients 3.0-19.75 years old with symptomatic SCD AND one or more of the following complications: (1)-(i) a clinically significant neurologic event (stroke) or any neurologic defect lasting > 24 hours and accompanied by an infarct on cerebral magnetic resonance imaging (MRI); OR, (ii) patients who have a Transcranial Doppler (TCD) velocity that exceeds 200 cm/sec by the non-imaging technique (or TCD measurement of >185 cm/sec by the imaging technique) measured at a minimum of 2 separate occasions one month or more apart; OR, (2) Minimum of two episodes of acute chest syndrome within the preceding 2-year period defined as new pulmonary alveolar consolidation involving at least one complete lung segment (associated with acute symptoms including fever, chest pain, tachypnea, wheezing, rales, or cough that is not attributed to asthma or bronchiolitis) despite adequate supportive care measures; OR, (3) History of 3 or more severe pain events (defined as new onset of pain that lasts for at least 2 hours for which there is no other explanation) per year in the 2 years prior to enrollment despite adequate supportive care measures (if patients are receiving hydroxyurea and compliant with therapy, being symptomatic is an indication for transplantation; however, if patients decline hydroxyurea or non-compliant with this therapy, they would still remain eligible for study if pain criteria as described above are met). Lansky/Karnofsky performance score must be ≥ 40. Hemoglobin S must be ≤ 45%. Patients must have an unrelated adult bone marrow donor who is HLA-matched at 8 of 8 HLA-A, -B, -C and -DRB1 at high resolution using DNA-based typing. Patients with bridging fibrosis or cirrhosis of the liver, with uncontrolled bacterial, viral, or fungal infection in the past month, or seropositivity for HIV are excluded. Patients with HLA-matched family donors, or who have received prior HCT, and females who are pregnant or breast feeding are excluded. Thirty patients were enrolled on this study and of these, 29 patients met the criteria and proceeded to the study transplant.DesignParticipants attended a study visit prior to the transplant to undergo a blood collection, neurocognitive testing to measure learning and brain function, magnetic resonance angiogram (MRA) and magnetic resonance imaging (MRI) scans. Questionnaires to assess quality of life were also completed. All patients received erythrocyte transfusions before transplant. Twenty-two days (-22) before the transplant, participants began receiving a reduced intensity conditioning regimen of chemotherapy and medications. On days -21, -20, and -19 participants weighing 10 kg or more received 10 mg, 15 mg, and then 20 mg of Alemtuzumab intravenously (IV) followed by 30 mg/m2/day IV on days -8 through -4 of Fludarabine. Eight days (-8) before the transplant, participants were admitted to the hospital to continue the conditioning regimen which included 140 mg/m2 IV of Melphalan on day -3. Participants received the bone marrow transplant on day 0. Prophylaxis for GVHD consisted of a calcineurin inhibitor (tacrolimus or cyclosporine) administered from day -3 through day 100 after graft infusion, with subsequent taper through day 180; methotrexate 7.5 mg/m2 on days 1, 3, and 6; and methylprednisolone 1 mg/kg per day from days 7 through 28, with subsequent taper by 20% per week. One week after the transplant continuing until the WBC is normal, participants received granulocyte-colony-stimulating factor (G-CSF). After leaving the hospital, participants attended study visits weekly during weeks 1 to 8, at day 60, weekly during weeks 9 to 14, at Day 100, at month 6, and at years 1 and 2. At all study visits, a blood collection, medical history review, and physical exam occurred. In addition, at day 100, month 6, and years 1 and 2, questionnaires to assess quality of life were completed. At select visits the following procedures were conducted: lung function testing, heart function testing, MRA and MRI scans, and neurocognitive testing.The primary outcome was 1-year EFS. Death, disease recurrence or graft rejection by 1 year were considered events for this endpoint.ConclusionsThe trial met its prespecified 1-year EFS, and significantly improved HRQL was reported posttransplant. However, although the Reduced-intensity conditioning (RIC) provided successful engraftment in most patients, the regimen cannot be considered safe for widespread adoption without modification due to the regimen-related toxicity (RRT) and high rate of chronic GVHD, which was the predominant cause of mortality.

  Study phs003470

• Mid-frequency hearing loss is a characteristic clinical feature of OTOA-associated hearing loss

  In this study, we performed NGS analysis of a large Japanese hearing loss cohort, and identified 7 patients with OTOA-associated hearing loss. As novel clinical features identified in this study, the audiometric configurations of OTOA-associated hearing loss patients was found to be mid-frequency.

  Study JGAS000200

• CEITEC DAC

  A CEITEC Data Access Committee (DAC) is a body of one or more named individuals who are responsible for data release to external requesters. The members of DAC are selected members of research groups and their respective leaders. Multiple datasets may be affiliated to a single DAC. DAC continues communication with requester to understand the purpose of use, i.e. research setting the dataset is envisioned for by requester, to identify if data sharing is possible directly under current conditions for the dataset, or actions such as re-consenting is needed and desirable to accommodate the proposed research setting/data use.

  Dac EGAC50000000049

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• 120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  Study EGAS00001001733

• Hip OA Functional Genomics RNAseq (2017-06-09)

  From 9 patients undergoing hip joint replacement surgery for osteoarthritis, we collected 3 cartilage samples each: a low-grade sample (no obvious evidence of damage or fibrillation); a high-grade sample (damaged and fibrillated cartilage); an osteophytic sample (overlaid bony protrusions mainly around the margins of the articular surface). Multiplexed libraries were sequenced on Illumina HiSeq 2000 (75bp paired-end read length) and a cram file was produced for each sample. This dataset contains all the data available for this study on 2017-06-09.

  Dataset EGAD00001003354

• Long-read sequencing identifies a common transposition haplotype predisposing for CLCNKB deletions

  Long-read whole genome sequencing, long-read long-range PCR sequencing, targetted long fragment long-read sequencing data of the CLCNKA/CLCNKB locus in 27 Bartter syndrome patients. Multiple different deletion alleles are identified and a new common transposition haplotype predisposing for CLCNKB deletions is described.

  Study EGAS00001007339

• RNASeq_EGAS00001001306

  RNASeq sequencing. Each library was sequenced using TruSeq SBS Kit v3-HS, in paired-end mode with a read length of 2 × 76 bp. We generated more than 20 million paired-end reads for each sample in a fraction of a sequencing lane on HiSeq2000 (Illumina Inc.) following the manufacturer’s protocol. Image analysis, base calling and quality scoring of the run were processed using the manufacturer’s software Real Time Analysis (RTA 1.13.48) and followed by generation of FASTQ sequence files.

  Dataset EGAD00001001443

• Analysis of tumor periphery and center-specific mutations in renal cell carcinoma

  Renal cell carcinoma (RCC) is a genomically heterogeneous tumor. In the present project, the question whether intratumoral heterogeneity follows a zonal pattern indicating spatial niches was addressed. Whole exome sequencing of 16 paired samples from tumor periphery and center revealed a number of region-specific functional SNVs and Indels. Therefore, RCCs are not composed of evenly admixed tumor cells but show topological differences in their clonal composition.

  Dataset EGAD00001002067

• Whole exome sequencing of young onset Primary Sclerosing Cholangitis

  Primary sclerosing chloangitis is a rare autoimmune disease of the liver (prevalence =10/100,000) with a mean age of onset of 40 years. We are currently undertaking GWASand immunochip experiments to identify loci underlying PSC susceptibility. Through ourcollaborators at the University of Calgary we have access to DNA from three parent-offspringtrios where the children required liver transplants due to PSC before the age of 9. These areextremely rare cases indeed and we believe that exome-sequencing represents a powerfulmeans of identifying the causal mutation underlying this severe phenotype.

  Dataset EGAD00001000671

• microRNA-seq of human serum from a longitudinal study of 66 women with no history of cancer

  This dataset includes microRNA sequencing data from 198 human serum samples, representing a subset of 66 women with no history of cancer who participated in the UKCTOCS study and with serum samples collected at three timepoints over a period of up to 5 years. Small RNA libraries prepared from the serum samples were sequenced with 50-bp single end reads on an Illumina HiSeq 2000 instrument. Data is provided as FASTQ files.

  Dataset EGAD00001004348