17510 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..Y2KA"

in 68.03 milliseconds.

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• A neoadjuvant, phase II trial demonstrates efficacy and tolerability of Talimogene laherparepvec in cutaneous basal cell carcinoma (NeoBCC trial)

  This dataset is related to the NeoBCC trial and includes 12 human tissue samples

  Dataset EGAD50000000371

• APCIM_Nanostring_FAP

  Expression of immune related genes in 12 familial adenomatous polyposis patients. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002553

• APCIM_Nanostring_HD

  Expression of immune related genes in 12 healthy donors. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002554

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• HERBY trial RNASeq

  RNA sequencing of non-brainstem paediatric high grade glioma from the HERBY phase II randomised trial. RNA from fresh frozen surgical tissue in 20 cases was subjected to Illumina whole transcriptome paired end sequencing. Data is provided as paired-end FASTQ files

  Dataset EGAD00001004070

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003957

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003975

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• RNA bam files of Renal Cell Carcinoma patients

  the dataset contains RNA bam files of Renal Cell Carcinoma patients, which belongs to "An Empirical Approach Leveraging Tumorgrafts to Dissect the Tumor Microenvironment in Renal Cell Carcinoma Identifies Missing Link to Prognostic Inflammatory Factors"

  Dataset EGAD00001003895

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003909

• Sequencing-based counting and size profiling of plasma Epstein-Barr virus DNA enhance population screening of nasopharyngeal carcinoma.

  We used targeted sequencing to capture and measure the abundance as well as the size profiles of EBV DNA in plasma of subjects with and without NPC

  Dataset EGAD00001004204

• Primary plasma cell leukemia genomic abnormalities

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 20 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001004323