16148 results for "free fc coins and points Visit Buyfc26coins.com Alennukset toistuvista ostoista..p4v2"

in 19.48 milliseconds.

• Tumor Profiler Project - AML scDNA data

  The dataset contains single-cell DNA seq data from 21 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000824

• Tumor Profiler Project - MEL bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 80 samples from 77 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000851

• Tumor Profiler Project - MEL scDNA data

  The dataset contains 10x Chromium single-cell DNA sequencing data from 63 samples from 60 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000852

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• PRPH2-Related Retinal Dystrophies

  NGS dataset including patients affected by genomic variants at gene PRPH2. It includes NGS test using custom IRD gene panels, clinical exome sequencing (CES) and whole-exome sequencing (WES).

  Dataset EGAD50000001239