16464 results for "sec+and+unspecified+malignant+neoplasm"

in 75.89 milliseconds.

• BAM files: Brain transcriptome of hereditary cerebral haemorrhage with amyloidosis–Dutch type (HCHWA-D)

  cDNA depleted RNA (500ng total RNA input) was fragmented to 150-200 nucleotides in first strand buffer for 3 minutes at 94°C. Random hexamer primed first strand was generated in presence of dATP, dGTP, dCTP and cTTP. Second strand was generated using dUTP instead of dTTP to tag the second strand. Subsequent steps to generate the sequencing libraries were performed with the KAPA HTP Library Preparation Kit for Illumina sequencing with minor modifications, i.e., after indexed adapter ligation to the dsDNA fragments, the library was treated with USER enzyme (NEB_M5505L) in order to digest the second strand derived fragments. After amplification of the libraries, samples with unique sample indexes were pooled and sequenced paired-end 2x50bp on a HiSeq2500 system following standard Illumina guidelines.

  Dataset EGAD00001003806

• RNA-seq of human iPSC-derived neurons to explore cellular phenotypes associated with schizophrenia.

  This dataset contains high-throughput RNA-sequencing of 12 samples, each sample comprising neural precursor cells derived from human induced pluripotent stem cells from individuals with and without the 16p13.11 microduplication (a copy number variant associated with a range of neurodevelopmental disorders). 4 samples derive from patients carrying the 16p13.11 microduplication, and 8 derive from unaffected family controls. RNA samples were processed to deplete rRNA using the TruSeq Stranded Total RNA with Ribo-Gold kit. Libraries were then sequenced using the NextSeq 500/550 High-Output v2 Kit on the Illumina NextSeq 550 platform, to produce 75 base pair paired-end sequencing reads at an average depth of around 100 million reads per sample. Raw sequencing reads data are stored in two FASTQ files per sample for these paired-end reads.

  Dataset EGAD00001004064

• Data distribution Statistics

  EGA Statistics Bibliography Growth Community Archive Distribution Catalogue Here, we show the amount of data distributed by the EGA. Data Distributed / Live EGA Data Distribution / Live SFTP Aspera HTSGET lineChartLive("svg#ega-dist-live", document.querySelector("#ega-figure-dist-live figcaption")); Data Distributed The below figure represents the cumulative EGA data distribution via the download clients(v2 and v3.x api versions) using HTTPS, FTP, and download boxes using ASPERA. You can see cumulative values by clicking "Cumulative". EGA Data Distribution //lineChart('#ega-data-distribution svg.stats', 'https://stats.ega-archive.org/distribution', // ['Amount of Distributed Data', ['Aspera', 'Download Clients', 'Total']]) curveChart('#ega-data-distribution', [ { domId: 'stats-aspera', label: 'Aspera', url: 'https://stats.ega-archive.org/distribution/aspera' }, { domId: 'stats-sftp' , label: 'SFTP', url: 'https://stats.ega-archive.org/distribution/sftp' }, //{ domId: 'stats-htsget', label: 'HTSGET', url: 'https://stats.ega-archive.org/distribution/htsget' }, { domId: 'stats-streamer' , label: 'Download Client', url: 'https://stats.ega-archive.org/distribution/streamer' }, { domId: 'stats-total' , label: 'Total', url: 'https://stats.ega-archive.org/distribution/total' } ] );

  Documentation about/statistics/distribution

• Bulk_sequencing_study_for_human_male_germline

  This study aims to understand the gene expression changes in male reproductive tissues during spermatogenesis using integrated multi-omics analysis. Different populations from testis biopsies, including spermatogonia stem cells, primary spermatocytes, secondary spermatocytes, spermatids and mature sperms, were sorted based on the DNA content. In addition to the G&T sequencing results for single cells, we sorted bulk samples for those populations for Nanoseq to detect the mutations at low error rate.

  Study EGAS00001005990

• Follow_up_for_second_tier_signals_from_the_arcOGEN_GWAS

  The arcOGEN UK nationwide consortium has been funded by the arc to undertake a genome-wide association scan in osteoarthritis. GWA genotyping has been carried out at the Sanger on the illumina 610k array. This replication study was desinged to follow-up second-tier signals from the arcOGEN GWS in 25 SNPs (1Sequenom iPLEX) with p<5x10^-6 on 6000 additional UK OA and control samples.

  Study EGAS00001001017

• Temporal Lobe Epilepsy and Retrotransposons

  Idiopathic (cryptogenic) epilepsy is a common, chronic group of brain disorders, affecting 1-2% of the US population, creating a significant public health problem because of the associated morbidity and mortality. One subtype of this complex group of brain disorders, temporal lobe epilepsy (TLE), is particularly burdensome, because a substantial fraction of patients do not respond to anticonvulsant medications. If the seizure focus can be localized by imaging and/or EEG, the TLE patient often elects to have a partial resection of the affected temporal lobe, because they have daily seizures, despite multiple pharmacotherapy regimens. Although genetic risk is thought to play a role in TLE, identification of common risk alleles has had limited success. In the past 5 years, data have accumulated to prove that neuronal embryogenesis is accompanied by activation of LINE1 (L1) retrotransposons (RTPs) to an unexpected degree, such that developing neurons may accumulate de novo L1 insertions. This results in a substantial mosaicism within populations of CNS neurons. While most of these somatic de novo L1s will have little effect on neuronal function (perhaps because they occur in gene deserts or in large introns or in genes not required for that cell's function), some may interfere with normal neuronal activity because they have inserted into a gene needed by that particular neuron for normal function. If one or more functional de novo L1s occur early in CNS development, all the daughter neurons that derive from that neuronal precursor will also carry the L1 insertion, perhaps leading to a dysfunctional population of neurons destined to become an epileptic focus. This study leveraged CNS tissue (obtained at craniotomy) from patients with intractable TLE, who have undergone a therapeutic partial resection of one temporal lobe. Using fluorescence-assisted cell sorting of temporal lobe neuronal nuclei, followed by high-throughput sequencing and alignment to the reference genome, detection of de novo L1s will be done. In this manner, it is expected that de-novo intragenic L1s, contributing to idiopathic TLE, will be discovered.

  Study phs002067

• Sequencing data for oesophageal and related samples - Normals release 3 (RNA)

  Dataset EGAD00001003902

• Sequencing data for oesophageal and related samples - Normals release 5 (RNA)

  Dataset EGAD00001005384

• Sequencing data for oesophageal and related samples - Normals release 2 (RNA)

  Dataset EGAD00001003838

• Sequencing data for oesophageal and related samples - Normals release 4 (RNA)

  Dataset EGAD00001004022

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• CRC cell line RNA-seq

  RNA-Seq data for C32, CACO2, CL11, HT29, SW403, SW948 MSS CRC cell lines and HCEC-1CT normal colon cell line

  Dataset EGAD50000000297

• 16SV4 ribosomal RNA gene sequencing data

  16SV4 ribosomal RNA gene sequencing data of GI samples and associated mixed community cultures collected from pediatric patients at risk for IBD.

  Dataset EGAD50000000485

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• WGS of PDO in depleted media

  Whole genome sequencing profiling of 7 PDAC patient-derived organoids (PDO) grown in a culture medium lacking both WNT3A and RSPO1- WGS unmapped reads, sequenced using NovaSeq 6000, 15x coverage 160 million reads per sample.

  Dataset EGAD50000000282

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958