17513 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 18.74 milliseconds.

• GELATO clinical trial whole exome sequencing data (primary tumors and local recurrences)

  Paired-end whole exome sequencing of 10 lobular breast cancer primary tumors, 3 local recurrences and matched normal samples obtained from 10 unique patients from the GELATO clinical trial. The included raw sequencing data in fastq format was generated using Illumina NovaSeq 6000 from archived FFPE material (tumor data) and fresh frozen material (matched normal data).

  Dataset EGAD00001009836

• Paired-WGS-two-families-with-GBA-variants-and-Parkinsons-disease

  We performed whole- genome sequencing, rare variant filtering, segregation analysis and functional validation of PD cosegregating rare genetic variation in two families (6 samples) segregating PD associated GBA variants c.115+1G>A (ClinVar ID: 93445, ) and p.L444P (ClinVar ID: 4288) respectively. The paired WGS sequencing was run on HiSeq X Ten and the library preparation kit was Illumina TruSeq DNA nano.

  Dataset EGAD00001006561

• Epigenomic analysis of human dopaminergic neuron differentiation reveals LBX1, NHLH1 and NR2F1/2 as necessary for lineage specification

  Sample information: The 56 samples produced in this project come from the human iPSC line GM17602 (Coriell) where a tyrosine hydroxylase-T2A-mCherry reporter was inserted. A combination of epigenetic analysis (ATAC/ChIP) along transcriptomics.

  Dataset EGAD00001009288

• Exome sequencing of lung tissue conducted in SMC

  The data includes exome sequencing FASTQ files of 335 patients receiving immune checkpoint blockade therapy. The data only provides for WXS of tumor tissue.

  Dataset EGAD00001009101

• Intra-prostatic tumour evolution, steps in metastatic spread and histogenomic associations revealed by integration of multi-region whole genome sequencing with histopathological features

  We performed whole genome sequencing on 42 prostate cancer samples from the prostate, seminal vesicles and regional lymph nodes of five treatment-naive patients with locally advanced disease who underwent radical prostatectomy. Whole genome sequencing was performed as 150bp paired end reads on the Illumina NovaSeq 6000 platform.

  Dataset EGAD00001011174

• WXS Normal Samples Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011321

• Paired-end Whole Exome-seq analysis of multi-centric lower grade glioma

  This dataset includes Nimblegen SeqCap EZ Exome v3 data for each lesion of three patients with multicentric glioma. For two patients, each lesion was sequenced along with whole blood. For a third patient, 3 pieces from the right lesion and 4 pieces from the left were sequenced along with whole blood. In each case BAM files that have been aligned with BWA mem alignment are available.

  Dataset EGAD00001003795

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302