17298 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 20.49 milliseconds.

• Ribosomal profiling on Epstein-Barr virus transformed B-lymphoblastoid cell lines

  Epstein-Barr virus-transformed B-lymphoblastoid cell lines from six individuals (HG00114, HG00282, NA12005, NA12044, NA12717 and NA12751) of the GEUVADIS Project were selected for ribosomal profiling. For each EBV-LCL, 20 million cells were treated with 2 μg/ml harringtonine and 100 μg/ml cycloheximide. After lysing cells in lysis buffer supplemented with 100 μg/ml cycloheximide, ribosome complexes were purified by density purification. Small RNA molecules were isolated using the NucleoSpin miRNA Kit (Bioke, Leiden, Netherlands), followed by RNA PAGE gel separation. Universal linkers were added after dephosphorylation. After reverse transcription, the cDNA was circularized and, after ribosomal RNA depletion, barcoded and sequenced on Illumina NextSeq 500.

  Dac EGAC50000000209

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• EM-seq data from plasma cfDNA samples of ALS patients, control and C9-carriers

  This dataset contains targeted EM-seq data from 61 plasma cfDNA samples spanning 20 sporadic ALS, 10 C9orf72-ALS, 10 asymptomatic C9orf72 expansion carriers, and 21 non-disease controls. Libraries were prepared with the NEBNext Enzymatic Methyl-seq (EM-seq) kit, captured using the Twist Human Methylome Panel (3.98 M CpGs; 123 Mb), and sequenced on Illumina NovaSeq 6000 (150 bp paired-end; ~45× on-target depth) with unmethylated lambda DNA spike-in and a 20% PhiX balance library. The dataset includes per-sample gzipped FASTQ files (R1/R2) and minimal metadata.

  Dataset EGAD50000001808

• Whole Genome Sequences of 18th century African descended individuals from Charleston, South Carolina.

  This study presents Whole Genome Sequencing results from the Anson Street African Burial Ground Project, which is a community-based initiative aimed at understanding the histories of 37 Ancestors in Charleston, South Carolina. Here we report fastq files for all 37 Ancestors. DNA was extracted at the University of Tennessee-Knoxville following Dabney et al. 2013, and dual index libraries prepared using a modified NEBNext Ultra II kit with partial USER enzyme digestion. Libraries were then enriched for human genomic DNA (MyBaits) and sequenced on Illumina Platforms.

  Dataset EGAD00001009643

• Blood plasma and FFPE derived total RNA seq dataset from DLBCL and PMBCL patients

  Blood plasma samples (n=168) and matched diagnostic formalin-fixed paraffin-embedded (FFPE) tissue samples (n=69) of DLBCL patients, PMBCL patients and healthy controls were collected between 2016-2021. Plasma samples were collected at diagnosis, at interim evaluation, after treatment, and in case of refractory or relapsed disease. RNA was extracted from 200 µl plasma using the miRNeasy serum/plasma kit and from FFPE tissue using the miRNeasy FFPE kit. RNA was subsequently sequenced on a NovaSeq 6000 instrument using the SMARTer Stranded Total RNA-seq pico v3 library preparation kit.

  Dataset EGAD00001011679

• ProstOmics - Spatial Transcriptomics

  Spatial transcriptomics data (ST) from 32 human prostate tissue samples originating from 8 prostate cancer patients (5 patients with post-surgery relapse). The ST data was acquired using the Visium Spatial Gene Expression kit which resulted in over 20 000 spatially defined spots for the 32 tissue samples. The raw transcriptomics data is RNA-seq. The individual samples have information on patient origin and sample type (cancer, cancer-adjacent field-effect normal or normal sample far from cancer). Each ST spot has metadata such as sample origin, histology class (stroma, normal epithelium, cancer of various grading etc), number of cells and estimated cell type fractions. Patient metadata include information of age at surgery, time (months) until reported relapse, total follow-up time, pre-surgery PSA, post-surgery T-stage and metastasis status.

  Dataset EGAD50000000603

• Bulk and Single-Nuclei RNA-seq with ATAC-seq of Breast Tumors Pre- and Post-Palbo ciclib/Endocrine Therapy

  This dataset comprises bulk and single-nuclei multiomic profiles from patients with ER+/HER2- early breast cancer enrolled in the NeoRHEA phase 2 trial. The bulk RNA-seq component includes 78 pre-treatment and 49 post-treatment tumor samples from 97 patients. The single-nuclei component includes matched pre- and post-treatment samples from 37 patients, totaling 63 samples analyzed by simultaneous snRNA-seq and snATAC-seq. Combined, the data contains bulk transcriptional profiles and single-nuclei gene expression/chromatin accessibility matrices for over 226,000 high-quality nuclei, encompassing tumor, immune, and stromal cells. Technologies used include Illumina NovaSeq 6000 for sequencing and the 10x Genomics Chromium platform (Multiome kit for single-nuclei, standard RNA library prep for bulk).

  Dataset EGAD50000002038

• GWAS on covid-19 severity and susceptibility in the province of Bergamo, Italy

  This is a case-control GWAS that involved the voluntary recruitment of inhabitants of the Bergamo province via an online questionnaire. We collected detailed clinical data and verified all information through personal interviews. Cases (severe COVID-19; G1) and controls (mild or asymptomatic COVID-19, G2; non-infected, G3) were matched by age, sex and risk factors

  Study EGAS00001007310

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• DKFZ-St.Jude Medulloblastoma - 218 CEF control exomes

  218 control exomes, CEF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006659

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Analysis File for 87 Argentinean individuals

  VCF for 87 Argentinean samples. Only SNPs (no indels) that passed the Affymetrix QC. Data from Luisi et al. 2020. Plos One. Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina. Reference Allele column does NOT contain reference allele from genome assembly.

  Dataset EGAD00001006227

• Oncogenic FOXL2C134W has gain-of-function chromatin remodeling activity that reprograms glucocorticoid receptor occupancy to promote ovarian granulosa cell tumor growth

  This dataset contains bam files from the whole exome sequencing performed on granulosa cell tumors and 7 sequencing experiments performed on human-derived KGN granulosa cell tumor cells and isogenic cell lines. The latter include transcription factor ChIP-seq for Foxl2 as well as transcription factor ChIP-seq for Foxl2 and GR under dexamethasone treatment and untreated conditions, two ATAC-seq data sets, two RNA-seq data sets, and Histone marks ChIP-seq.

  Dataset EGAD50000000880

• Mutational analysis of an oligoprogressive sarcomatoid hepatocellular carcinoma treated with an immune checkpoint inhibitor.

  The dataset is composed of three sequenced tumor samples: (I) Meta-bone-557 (bone metastasis obtained from occipital lesion resection during treatment with Liposomal doxorubicin); (II) Meta-CNS-888 (brain metastasis obtained from surgical resection during treatment with Nivolumab); (III) Primary-liver-463 (primary hepatic tumor obtained from surgical resection during treatment with Nivolumab). Genomic DNA from tumor samples was extracted using GeneRead DNA FFPE kit (Qiagen), containing Uracyl-D Glycosylase, according to the manufacturer’s instructions. Whole-exome libraries were prepared using SureSelect XT Clinical Research Exome Target Enrichment kit (Agilent Technologies # 5190-7338). Sequences (150bp paired-end) were generated on a NextSeq 500 sequencing platform (Illumina).

  Dataset EGAD00001006982