17511 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 22.33 milliseconds.

• lpWGS of solid and liquid samples from female patients with metastatic breast cancer

  low-pass Whole Genome Sequencing (lpWGS) to assess the representativeness of seven body liquids from female patients with metastatic breast cancer. 20 patients. 216 liquid samples, 745 solid samples, 20 matched normal samples. 0.5X coverage. Illumina single read sequencing. Fastq files are provided. lpWGS from Richard et al., Nature Communications, 2025.

  Dataset EGAD50000001851

• Targeted sequencing data on sequential liquid biopsy samples from CSPC patients

  Sequencing data from newly diagnosed high emtastatic burder prostate cancer patients receiving an AR pathway inhibitor (ARPI) or docetaxel. Targeted sequencing data of prostate cancer relevant genes using the PCF-SELECT capture panel. cfDNA from PreADT, baseline, on-treatment (Cycle1 to 6) taken on ARPI or Docetaxel were sequenced as well as patient-matched WBC DNA

  Dataset EGAD50000001960

• Cancer Research UK Manchester Institute/ Cancer Research UK National Biomarker Centre Data Access Committee

  Cancer Research UK Manchester Institute/Cancer Research UK National Biomarker Centre Data Access Committee is created to • Review and approve data access requests. • Ensure data security and compliance with institutional and legal obligations. • Maintain accurate records of access decisions For questions or further information, please contact: Chair of the Data Access Committee: Caroline Wilkinson Email: dac@cruk.manchester.ac.uk

  Dac EGAC50000000795

• Single-cell whole-genome sequencing dataset of sorted CD3+, CD33+, and CD34+ cells from aplastic anemia

  This dataset contains raw single-cell whole-genome sequencing data generated from a single patient with aplastic anemia using the BioSkryb platform. Single cells were isolated based on surface marker expression (CD3+, CD33+, and CD34+) and subjected to whole-genome amplification followed by sequencing on an Illumina platform.

  Dataset EGAD50000002195

• 2 10X multiomics (RNA+DNA) gray matter brain controls donors

  Single cell multiomics from 2 donor controls, expression and chromatin accessibility. Samples belong to gray matter tissue from the brain.

  Dataset EGAD00001008457

• Single-nucleus Isoforms of Down Syndrome Brains (long-read)

  16 DS and Control brains samples were prepared using the 10X Genomics Single Cell 3' v3 kit. Pre-fragmented cDNA libraries were loaded onto a Pacific Biosciences Sequel II to sequence single-nucleus isoforms.

  Dataset EGAD00001008286

• DNA methylation-based classification of sinonasal tumors [DNA sequencing]

  This dataset contains raw exome sequencing data from nine sinonasal undifferentiated carcinoma FFPE samples and matched normal tissue that were assigned to a shared epigenetic class using DNA methylation-based classification. They were analyzed using the Twist Human Core Exome Plus Kit (Twist Bioscience) on a NovaSeq 6000 sequencer.

  Dataset EGAD00001009668

• RNAseq profiling of pediatric osteosarcoma

  Primary pediatric osteosarcoma samples were collected and profiled using RNAseq. When possible, germline and tumor samples were collected. For some patients, multiple tumor tissues were collected and sequenced. Some of the samples were used to derive PDTX models, which were also profiled with RNAseq. Paired end sequencing was performed on Illumina HiSeq instruments and FASTQ files reported.

  Dataset EGAD00001004538

• Transcriptome and Exome from longitudinal samples of human glioblastoma (newly added after 2015)

  We expanded our previous collection of longitudinal GBM patients (EGAS00001001041) by recruiting 21 additional patients. Tumor specimens were subjected to whole-exome sequencing (16 of 21 cases, with the matched normal/blood) and transcriptome sequencing (16 of 21 cases).

  Dataset EGAD00001002143

• Genomic Profiling of Advanced Pancreatic Cancer to inform therapy - WGS mapped reads

  Genomics-Driven Precision Medicine for Advanced Pancreatic Cancer - Early Results from the COMPASS Trial - WGS mapped reads

  Dataset EGAD00001003585

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Exploring the extracellular transcriptome in seminal plasma for non-invasive prostate cancer diagnosis

  mRNA capture sequencing data of 57 seminal plasma samples.

  Dataset EGAD00001007688

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• Epilepsy related sudden death (2019-08-21)

  These samples include exome sequences of samples from patients who suffered Sudden Unexplained Death in Epilepsy. They all are of European descent. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005276

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell transcriptomes of of primary tumors and normal endometrial derived organoids treated with DBZ

  Endometrial carcinoma, the most common gynecologic cancer, develops from endometrial epithelium which is composed of secretory and ciliated cells. Pathologic classification is unreliable and there is a need for prognostic tools. We used single cell sequencing to study organoid model systems derived from normal endometrial endometrium to discover novel markers specific for endometrial ciliated or secretory cells. We performed single cell sequencing on endometrial and ovarian tumours, and on organoids both treated with DBZ and normal and found both secretory-like and ciliated-like tumour cells.

  Dataset EGAD00001006280

• Whole exome sequencing data of tumor/normal pairs for the study "TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells"

  Tumor DNA was extracted from formalin-fixed and paraffin embedded tumors of a large cohort of bladder cancer patients before treatment with anti-PD-L1. Normal DNA was extracted from matched PBMCs. Whole exome sequencing was performed. This is a subset of patients for which RNA sequencing is also provided (with more detailed phenotypic information).

  Dataset EGAD00001004218