7190 results for "({!join from=dataset_studies to=id v=$q1}) OR ("transcriptome" OR "RNA-seq" OR "rna sequencing" OR "rna-sequencing")"

in 214.39 milliseconds.

• Mate-pair sequencing of 12q-amplified osteosarcomas

  Mate-pair sequencing of 12q-amplified osteosarcomas for the detection of structural variants. This was carried out in order to study the structure of the chromosome 12q-amplicons and whether material from other chromosomes is also intertwined and amplified in a bid to further characterise these tumours beyond CDK4 and MDM2 amplification. Mate-pair data was also used to verify gene fusions detected with RNA-seq.

  Study EGAS50000000493

• Molecular profiling for a patient with lipoblastoma-like tumor of the vulva

  Lipoblastoma-like tumors of the vulva (LLTVs) are exceptionally rare indolent adipocytic mesenchymal tumors arising in adults. Only total 19 cases have been reported previously and has just been categorized as mesenchymal tumours of the lower genital tract on the latest WHO classification of tumours, 5th edition. This is the first case of LLTV assessed for RNA-seq, WES, and WGS by next generation sequencing.

  Study JGAS000529

• Novel manifestations of immune dysregulation and granule defects in gray platelet syndrome

  Gray Platelet Syndrome (GPS) is a rare recessive bleeding disorder resulting from biallelic variants in NBEAL2. As part of a comprehensive evaluation of the phenotype and genotype in 47 patients with GPS, four different blood cell-types (platelets, neutrophils, monocytes, and CD4-lymphocytes) were evaluated using bulk RNA-seq in five patients and five controls. These data are deposited in this archive in FASTQ format.

  Study EGAS00001004216

• QSEA – modelling of genome-wide DNA methylation from sequencing enrichment experiments

  We describe a new method, QSEA, for analyzing methylation enrichment data. We generated a benchmark experiment consisting of MeDIP-seq enrichment data, targeted BS-seq validation data, and RNA-seq data on five pairs of tumor and adjacent normal samples of non-small cell lung cancer patients. Details of the method and its performance on the data have been described in Lienhard et al. (2016).

  Study EGAS00001001822

• 46 patients primary malignant glioma cohort in Chinese population

  We recruited 46 Chinese patients with primary malignant glioma. All the patients were analyzed with whole-exome sequencing (WES) and 27 of them were analyzed with RNA-seq. We compared the molecular features between patients in different WHO grades. We used six-month progression-free survival (PFS6) status to group glioblastoma (GBM) patients to a good and a poor survival compared two groups genomic profiles.

  Study EGAS00001005583

• A single-cell transcriptional gradient in human cutaneous memory T cells restricts Th17/Tc17 identity

  We identified a gradated transcriptional program of coordinately regulated inflammation-suppressive genes in psoriatic resident memory T cells. This dataset includes bulk RNA-seq for CRISPR-based deactivation of two core components of this inflammation-suppressive program, ZFP36L2 and ZFP36, in human PBMCs. It also includes scRNA-seq of cutaneous immune cells from psoriasis patients before and during therapeutic IL-23 blockade.

  Study EGAS00001006716

• Genomic Studies of Bipolar Disorder in a Large Cohort from The Netherlands

  The transcriptomes of whole blood samples of a large cohort of individuals from the Netherlands were assayed using RNA-seq. These whole blood samples included patients diagnosed with schizophrenia or bipolar disorder, family members of patients, and healthy controls. Within the whole blood dataset, about 600 of the samples were sequenced to an average of 13.9 million mapped reads per sample, while about 2,000 were sequenced to an average of 5.9 million mapped reads per sample, in order to assess changes in power to detect eQTLs based on sample size. We find that expression, defined as the log transcripts per million reads (TPMs), is highly correlated when comparing the moderate (13.9M) and lower (5.9M) coverage datasets. Additionally, a subset of about 150 individuals provided fibroblast cell lines which were assessed for the levels of gene expression using RNA-seq at an average of 50 million mapped reads per sample. We use downsampling techniques to generate synthetic datasets derived from this real fibroblast RNA-Seq data to explore the relationship between coverage and number individuals in an eQTL analysis. Corresponding individual-level genotypes for the samples included in the expression matrix are also made available. The genotypes were derived from multiple other project cohorts, each using different genotyping platforms including OmniExpress Exome, Global Screening Array, Illumina550, and PsychChip. A Plink file set of these cohorts is provided here after merging the separate project file sets and extracting only the individuals who have expression data also provided here; quality control for SNP-missingness is recommended. We demonstrate in this study that given a fixed budget, eQTL discovery power can be increased by lowering the sequencing depth per sample to allow for an a greater number of individuals sequenced. 

  Study phs002856

• Using_genetics_to_identify_cell_types_and_mechanisms_underlying_susceptibility_to_primary_sclerosing_cholangitis

  Primary sclerosing cholangitis (PSC) is a T-cell mediated, chronic inflammatory condition of the biliary tree that is strongly associated with inflammatory bowel disease. Genome-wide association studies have identified 22 non-HLA genetic risk variants associated PSC. Identifying the genes impacted by these variants has proven difficult as the majority lie in non-coding regions of the genome. Knowledge of the genes and biological pathways these non-coding variants are perturbing is vital to understanding the disease biology. One means of assessing the impact of non-coding variants within disease associated loci upon genes is via colocalisation with eQTL. Many eQTL are cell-type specific, requiring the analysis of disease relevant cell types to detect colocalisation. We have collected PSC-relevant T-cell-subtypes from the peripheral blood of PSC patients via fluorescence activated cell sorting in preparation for RNA sequencing and mapping of eQTL. Samples were collected at the Norfolk and Norwich University Hopital, for which local ethical approval has been granted. Lysed cell samples will be transferred to WTSI and DNA/RNA will be extracted from lysed cell samples by T143 before genotyping (DNA) and custom library preparation and sequencing (RNA). This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001002642

• Developing Allelic Imbalance Analysis from Single-Nucleus RNA-Seq Data

  Single-cell RNA-seq (scRNA-seq) is emerging as a powerful tool for understanding gene function across diverse cells. Recently, this has included the use of allele-specific expression (ASE) analysis to better understand how variation in the human genome affects RNA expression at the single-cell level. We reasoned that, because intronic reads are more prevalent in single-nucleus RNA-Seq (snRNA-Seq) and introns are under lower purifying selection, and are thus enriched for genetic variants, that snRNA-seq should facilitate single-cell analysis of ASE. Here we demonstrate how experimental and computational choices can improve the results of allelic imbalance analysis. We explore how experimental choices, such as RNA source, read length, sequencing depth, genotyping, etc., impact the power of ASE-based methods. We developed a new suite of computational tools to process and analyze scRNA-seq and snRNA-seq for ASE. As hypothesized, we extracted more ASE information from reads in intronic regions than those in exonic regions and show how read length can be set to increase power. Additionally, hybrid selection improved our power to detect allelic imbalance in genes of interest. We also explored methods to recover allele-specific isoform expression levels from both long- and short-read snRNA-seq. Overall, we provide an end-to-end experimental and computational approach for future studies.

  Study phs003749

• 'KOREAN' never-smoker female adenocarcinoma RNA-seq

  Multi-layered genomic studies such as the TCGA project have greatly advanced our understanding on molecular pathogenesis of lung cancer. For Asian nonsmoker patients, however, majority of studies have been limited to mutational analyses, emphasizing ethnic differences in driver mutations (e.g. more frequent EGFR mutations and ALK fusions). In essence, a comprehensive multi-layered characterization that could lead to molecular etiology and patient stratification scheme to be translated into clinical applications for this patient group is still missing. Here we report molecular profiling of tumor and matched normal tissues from 114 non-small-cell lung adenocarcinoma patients using whole exome sequencing, transcriptome sequencing, and array comparative genomic hybridization (CGH).

  Study EGAS00001003789

• Knoll et al Identification of drug candidates targeting monocyte reprogramming in people living with HIV

  Introduction People living with HIV (PLHIV) are characterized by functional reprogramming of innate immune cells even after long-term antiretroviral therapy (ART). In order to assess technical feasibility of omics technologies for application to larger cohorts, we compared multiple omics layers. Methods Bulk and single-cell transcriptomics, flow cytometry, proteomics, chromatin landscape analysis by ATAC-seq as well as ex vivo drug stimulation was performed in a small number of blood samples derived from PLHIV and healthy controls from the 200-HIV cohort study. Results Single-cell RNA-seq analysis revealed that most immune cells in peripheral blood of PLHIV are altered in their transcriptomes and that a specific functional monocyte state previously described in acute HIV infection is still existing in PLHIV while other monocyte cell states are only occurring acute infection. Moreover, a reverse transcriptome approach on a rather small number of PLHIV was sufficient to identify drug candidates for reversing the transcriptional phenotype of monocytes in PLHIV. Discussion These scientific findings and technological advancements for clinical application of single-cell transcriptomics form the basis for the larger 2000-HIV multicenter cohort study on PLHIV, for which a combination of bulk and single-cell transcriptomics will be included as the leading technology to determine disease endotypes in PLHIV and to predict disease trajectories and outcomes.

  Study EGAS00001007460

• Dana-Farber Cancer Institute (DFCI) Wu Lab/Avicenne CLL RNA-Seq Study

  Chronic Lymphocytic Leukemia (CLL) is a hematological malignancy characterized by accumulation of CD5+ B cells in peripheral lymphoid organs, bone marrow and blood. Recently, the advent of large-scale whole-exome sequencing of hundreds of CLL samples has led to gain a comprehensive understanding of the mutational landscape of this clonal B cell malignancy, but the functional effects of the putative driver mutations thus discovered are largely unknown. In this study, we analyze RNA-seq data from CLL patients to characterize dysregulated biological pathways regarding the presence of recurrent mutations. Source of tumor is patients' PBMC isolated from peripheral blood using the Ficoll method. Purity was confirmed using flow cytometry flow (>80% in all cases).

  Study phs002335

• Multi-site tumor sampling highlights molecular intra-tumor heterogeneity in malignant pleural mesothelioma

  Background:Malignant pleural mesothelioma (MPM) is a heterogeneous cancer. Better knowledge of molecular and cellular intra-tumor heterogeneity throughout the thoracic cavity is required to develop efficient therapies. This study focuses on molecular intra-tumor heterogeneity using the largest series to date in MPM and is the first to report on the multi-omics profiling of a substantial series of multi-site tumor samples. Methods:Intra-tumor heterogeneity was investigated in 16 patients from whom biopsies were taken at distinct anatomical sites. The paired biopsies collected from apex, side wall, costo-diaphragmatic or highest metabolic sites as well as 5 derived cell lines were screened using targeted sequencing. Whole exome sequencing, RNA sequencing, and DNA methylation were performed on a subset of the cohort for deep characterization. Molecular classification, recently defined histo-molecular gradients, and cell populations of the tumor microenvironment were assessed. Results:Sequencing analysis identified heterogeneous variants notably in NF2, a key tumor suppressor gene of mesothelial carcinogenesis. Subclonal tumor populations were shared among paired biopsies, suggesting a polyclonal dissemination of the tumor. Transcriptome analysis highlighted dysregulation of cell adhesion and extracellular matrix pathways, linked to changes in histo-molecular gradient proportions between anatomic sites. Methylome analysis revealed contribution of epigenetic mechanisms in two patients. Finally, significant changes in the expression of immune mediators and genes related to immunological synapse, as well as differential infiltration of immune populations in the tumor environment were observed and led to a switch from a hot to a cold immune profile in three patients. Conclusions:This comprehensive analysis reveals patient-dependent spatial intra-tumor heterogeneity at the genetic, transcriptomic and epigenetic levels and in the immune landscape of the tumor microenvironment. Results support

  Study EGAS00001005328

• 20210729_EGA_BrainMet Saunus et al J Path (2015)

  Exome sequencing on HiSeq platform of 36 brain metastases with matched normal samples, 32 having matched RNA seq. Published Saunus et al J Path, (2015); https://doi.org/10.1002/path.4583

  Dataset EGAD00001007973

• OncoCis: Annotation of cis-regulatory mutations in cancer

  RNA-seq dataset used for the validation of CDK6 cis-regulatory mutation annotated by OncoCis. NB bam files for manuscript A_Proteomic_Chronology_of_Gene_Expression_through_the_Cell_Cycle_in_Human_Myeloid_Leukemia_Cells are now available at the following link:http://www.ebi.ac.uk/ena/data/view/ERP008483

  Dataset EGAD00001001019

• DAC_for_study__PDFs_RNA-seq_scRNA/TCR-seq

  Study: Pharmacologic inhibition of nonsense-mediated mRNA decay enhances anti-tumour immunity, R. Vendramin et al (2025), Cell Data details: Patient-derived fragments (PDFs) RNA-seq and scRNA/TCR-seq data; treatment: SMG1 inhibition (small molecule inhibitors) and knockdown of SMG1 (siRNA)

  Dac EGAC50000000725

• Patient tumour data (RNAseq, WGBS, ChIPseq, WGS)

  Content: 60 GB patient tumours and 4 normal brain samples combined in pairs by region (x2=8 total input samples). RNAseq: 1 lane per sample, total strand-specific rRNA-depleted (normal samples were combined = 2 lanes/samples per brain region). WGBS: 2 lanes per sample (normal samples were combined = 2 lanes/samples per brain region). ChIPseq (histone mark): a subset of 20 GB samples were profiled. For the same modification were multiplexed and sequenced on 4 lanes each (H3K27ac, H3K4me1) or a single lane (all others). WGS: used as matching input control for the 20 ChIPseq samples. Data type and technology: RNA-seq: PE 100bp sequenced on HiSeq2000. WGBS: PE 100bp sequenced on HiSeq2000/4000. ChIPseq: SE 50bp sequenced on HiSeq2000/4000. WGS: PE 150bp sequenced on HiSeq X.

  Dataset EGAD00001005492

• Ither2 RNA-Seq dataset - Implementation of pediatric precision oncology into clinical practice: The individualized Therapies for Children with cancer program “iTHER”

  iTHER is a prospective national precision oncology program aiming to define tumor molecular profiles in children and adolescents with primary very high-risk, relapsed, or refractory pediatric tumors in order to identify relevant aberrations to inform treatment.

  Dataset EGAD00001010179

• RNA-seq dataset

  RNAseq FASTq files from 728 bulk pre-treatment tumors from IMvigor010.

  Dataset EGAD00001007575

• Gene Expression of Small Cell Carcinoma of the Ovary-Hypercalcemic Type (SCCOHT)

  Small cell carcinoma of the ovary-hypercalcemic type (SCCOHT) is a rare and aggressive form of ovarian cancer afflicting young women at a median age of 24 years. SCCOHTs are characterized by loss of protein expression of SWI/SNF chromatin remodeling ATPases SMARCA4 and SMARCA2 through mutation and epigenetic silencing, respectively. This study aims to establish gene expression profiles of this cancer through RNA-Seq of fourteen pathologically confirmed cases of SCCOHT tumors.

  Study phs001528

• Prospective Procurement of Solid Tumor Tissue to Identify Novel Therapeutic Targets

  Recent advances and insights into the molecular pathogenesis of cancer have led to the development of novel molecular and biologic targeted therapies for the treatment of advanced cancer patients. A critical challenge in extending these studies involves the identification and validation of new therapeutic targets for future cancer therapies. In this study, we performed whole exome and RNA-Seq analysis metastases to determine the nature and frequency of somatic mutations.

  Study phs001003

• Reference Profiles of ExRNAs in Normal Human Pregnancy

  In this study, we did a comprehensive exRNA profiling of plasma and serum specimens from healthy pregnant women, sampled at different gestational time points, and including subjects with diverse geographical and ethnic backgrounds. This study also contains samples from male and female healthy donors to provide a baseline. The aim of this study is to identify miRNAs that can predict the gestation age and to build a miRNA profile across gestation using small RNA-seq data.

  Study phs003182

• Blood Gene Signatures Associated with Stiffness After TKA

  In this study, we used PAXgene Blood RNA tubes collected from patients undergoing total knee arthroplasty (TKA) for osteoarthritis. Samples were collected with IRB approval and patient consent. We identified 8 patients with knee stiffness after TKA (cases) and 10 patients without post-TKA stiffness (controls). We isolated RNA from cases and controls for RNA-seq analyses, comparing samples collected the day of surgery and samples collected at 24 hours after surgery.

  Study phs002927

• RNAseq of 76 samples from Uveal Melanoma tumors

  Hotspot mutations in the spliceosome gene SF3B1 are reported in 20% of uveal melanomas. SF3B1 is involved in 3'-splice site (3'ss) recognition during RNA splicing; however, the molecular mechanisms of its mutation have remained unclear. Here we show, using RNA-Seq analyses of uveal melanoma, that the SF3B1 R625/K666 mutation results in deregulated splicing at a subset of junctions, mostly by the use of alternative 3'ss

  Study EGAS00001002932

• Genetic regulation of RNA splicing in human pancreatic islets

  Genetic variants that influence transcriptional regulation in pancreatic islets play a major role in the susceptibility to type 2 diabetes (T2D). For many susceptibility loci, however, the mechanisms are unknown. To this end, we examined splicing and gene expression QTLs (sQTLs and eQTLs) in pancreatic islets from 399 human donors from publicly available cohorts and in-house data. Here we provide newly generated RNA-seq data and genotyping array data from 101 donors.

  Study EGAS00001006440

• Integrating Genomic and Transcriptomic Data to Identify Breast Cancer Susceptibility Genes

  Genetic factors play an important role in the etiology of both sporadic and familial breast cancer. Since 2007, common genetic variants in ~200 loci have been identified in genome-wide association studies (GWAS) in relation to breast cancer risk. However, it is often difficult to translate GWAS findings to disease prevention and treatment since causal genes in the large majority of GWAS-identified loci are unknown. Furthermore, a large fraction of breast cancer heritability remains unexplained. Recent studies suggest that nearly 80% of disease heritability can be explained by genetic variants regulating gene expression. Herein, we propose three well-powered transcriptome-wide association studies (TWAS) to systematically investigate the association of breast cancer risk with gene expression across the transcriptome of African, Asian and European descendants. In Aim 1, we will perform RNA sequencing and high-density genotyping assays using normal breast tissue samples, and build race-specific gene expression prediction models using data from 1000 women of African, Asian and European descent. These models will be applied to the GWAS data generated from approximately 320,000 breast cancer patients and controls to impute gene expression for association analyses of predicted gene expression with risk of breast cancer overall, and by estrogen receptor and HER2 status. In Aim 2, we will select the top 50 genes identified in Aim 1 for in vitro functional assays to assess their influence on major cell functions related to cancer biology. In Aim 3, we will evaluate whether TWAS-identified genes may express differently in normal breast tissues and breast cancer tissues collected from African, Asian, and European descendants to assess whether these genes may contribute to racial differences in breast cancer risk by molecular subtypes. With strong methodology and a large sample size, we believe that this proposed study should be able to identify and characterize a large number of novel genes related to breast cancer risk. Uncovering breast cancer susceptibility genes will greatly improve the understanding of the genetic and biological basis for breast cancer and accelerate the translation of genetic findings to disease prevention and patient care.

  Study phs003535

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• Clinical phenotype data

  Clinical data corresponding to the patients with ovarian cancer studied using scRNA-seq and bulk RNA-seq. Variables include molecular subtype, predicted immune phenotype, reviewing pathologist comment, final immune phenotype, histology characterization, and tumor stage.

  Dataset EGAD00001006973

• Spatial atlas of human atherosclerosis highlights role of the microvasculature in disease

  Atherosclerosis is a pervasive contributor to ischemic heart disease and stroke. Despite the advance of lipid lowering-therapies and antihypertensive agents, the residual risk of an atherosclerotic event remains high and developing therapeutic strategies has proven challenging. This is due to the complexity of atherosclerosis with a spatial interplay of multiple cell types within the vascular wall. Here we generate an integrative high-resolution map of human atherosclerotic plaques combining single-cell RNA-seq from multiple studies and spatial transcriptomics data from 12 human specimens, with different stages of atherosclerosis. We show cell-type and atherosclerosis-specific expression changes and spatially constrained alterations in cell-cell communication. We highlight the possible recruitment of lymphocytes via ACKR1 endothelial cells of the vasa vasorum, the migration of vascular smooth muscle cells towards the lumen by transforming into fibromyocytes, and cell-cell communication in the plaque region, indicating an intricate cellular interplay within the adventitia and the subendothelial space in human atherosclerosis.

  Study EGAS50000000660

• Spatial Transcriptomics Uncovers Tumor Microenvironment-Based Subtypes in Invasive Lobular Carcinoma

  Invasive lobular carcinoma (ILC) is the second most common histological subtype of breast cancer (BC); however, little is known about its tumor microenvironment (TME). Here, we investigated the spatial architecture of 43 hormone-receptor-positive, HER2-negative (HR+/HER2-) primary ILC samples, using spatial transcriptomics and detailed morphological annotation. By integrating morphology, spatial, and single-cell data, we mapped TME-related cell types, exploring their proximity to tumor cells and their enrichment in specific compartments. Clustering of spatial transcriptomics spots revealed significant inter- and intra-tumor heterogeneity, identifying pathways and cell types linked with disease outcomes. Morphological and gene expression data were finally integrated with a multimodal approach, leading to the identification of 4 new ILC subtypes based on TME heterogeneity. By using derived, specific gene expression signatures, these subtypes were identified and validated in external bulk RNA-seq/microarray datasets (SCAN-B and METABRIC), where differences in prognosis emerged.

  Study EGAS50000001001

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, Whole blood and various immune cell subsets from 119 Systemic Lupus Erythematosus (SLE), 65 Dermatomyositis & Polymyositis, 67 Systemic Sclerosis, 19 Mixed Connective Tissue Disease, 18 Sjogren's syndrome, 24 Rheumatoid Arthritis, 23 Behcet's disease, 18 Adult Onset Still���s Disease, 25 ANCA-associated Vasculitis, 16 Takayasu���s Arteritis and 141 healthy controls (C) were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, Mem_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, LDG, Neu). Whole genome sequencing was performed with whole blood samples. RNA-seq was performed with each immune cell subset samples. After filtering and normalization of the gene expression data, eQTL analysis was performed in each immune cell type. 15 immune cell subsets ATAC-seq was also performed in 8 SLE and HCs, each.

  Study JGAS000220

• RNA_seq_of_Toxoplasma_gondii_response_in_human_macrophages

  Toxoplasmosis is a zoonotic disease caused by a ubiquitous protozoan parasite called Toxoplasma gondii, which caninfect all mammal and bird species throughout the world. seroprevalence varies widely between countries. Studieshave estimated that between 7-34% of people in the UK have been infected with T. gondii. The vast majority of thesepeople will not have noticed any symptoms, however about 10% of people develop a mild to moderate self limitingflu-like illness. Following the acute active stage of the infection the parasite persists in the body in the form of cysts,particularly in heart and skeletal muscle and nervous system tissues, for many years, and usually for life. Inimmunocompetent persons these cysts do not pose a health risk. We will use RNA-seq to quantify the transcriptionalresponse of macrophages to T gondii infection.This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001001708

• Single_Cell_RNAseq_at_various_stages_of_HiPSCs_differentiating_toward_definitive_endoderm_and_endoderm_derived_lineages

  When comparing the differentiation capacities of pluripotent stem cell lines that have different genetic backgrounds, batch to batch experimental variablility poses a significant challenge, especially when trying to identify smaller effects. One way to address this issue is to differentiate several different lines in the same culture dish, thereby elimating experimental variation. In addition, it allows researchers to analyze many more lines with less experiments. Parallel single cell RNA-Seq exploits that individual cells are tagged and hence each cell can be reliably assigned to the donor of origin based on the genetic variants it contains. In addition, analyzing the genetic signature of single cells within a differentiating population can reveal differentation stages that are not easily detected in bulk RNAseq data. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001002278

• Molecular and clinical diversity in primary central nervous system lymphoma: a LOC network multi-omic PCNSL study

  Primary central nervous system lymphoma (PCNSL) is a distinct extranodal lymphoma presenting with limited stage disease but variable response rates to treatment despite homogenous pathological presentation. The likely underlying molecular heterogeneity and its clinical impact is poorly understood. The present dataset contents paired-ended whole-exome sequencing information (n=115; HyperExome Kapa hyperprep), paired-ended RNA-seq information (n=123; KAPA mRNA HyperPrep Kits), and paired-ended bisulfite sequencing (n=64; TruSeq Methyl Capture EPIC) from fresh-frozen tumor tissue immunocompetent, treatment naïve PCNSL patients. Additionally, the dataset includes single-ended RNA-seq (n=93; QuantSeq 3’ mRNA-Seq Library Prep Kit) from formalin-fixed, paraffin-embedded tissue of immunocompetent, treatment naïve PCNSL patients. All samples were sequenced in an Illumina NovaSeq 6000 instrument.

  Dataset EGAD00001008706

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - RNAseq

  Ependymomas (EPN) are the third most common malignant brain cancer in children. Treatment strategies for pediatric EPN have remained unchanged over recent decades, with 10-year survival rates stagnating at just 67% for children aged 0-14 years. Moreover, patients who survive treatment for the most common subtype of pediatric EPN (posterior fossa A (PFA)), often suffer long-term neurological side effects as a result of therapy. It is evident that there is a need for safer, more effective treatments for pediatric EPN patients. There are ten distinct subgroups of EPN, each with their own molecular and prognostic features. To identify and facilitate the testing of new treatments for EPN, in vivo laboratory models representative of the diverse molecular subtypes are required. Here, we describe the establishment of a patient-derived orthotopic xenograft (PDOX) model of PFA EPN, derived from a metastatic cranial lesion. Patient and PDOX tumors were analyzed using immunohistochemistry, DNA methylation profiling, whole genome sequencing (WGS) and RNA sequencing. Both patient and PDOX tumors classified as PFA EPN by methylation profiling, and shared similar histological features consistent with this molecular subgroup. RNA sequencing revealed that gene expression patterns were maintained across the primary and metastatic tumors, as well as the PDOX. Copy number profiling revealed gains of chromosomes 7, 8 and 19, and loss of chromosomes 2q and 6q in the PDOX and matched patient tumor. No clinically significant single nucleotide variants were identified, consistent with the low mutation rates observed in PFA EPN. Overexpression of EZHIP RNA and protein, a common feature of PFA EPN, was also observed. Despite the aggressive nature of the tumor in the patient, this PDOX was unable to be maintained past two passages in vivo. Others who have successfully developed PDOX models report some of the lowest success rates for EPN compared to other pediatric brain cancer types attempted, with loss of tumorigenicity not uncommon, highlighting the challenge in propagating these tumors in the laboratory. Here, we discuss our collective experiences with PFA EPN PDOX model generation and propose potential approaches to improve future success in establishing preclinical EPN models

  Study EGAS00001006844

• Analysis of genes related to the oncogenesis, progression or effectiveness of drug therapies of urological tumors .

  To clarify the oncogenesis and the progression mechanism of urological tumors, we continuously collect tumor samples of our patients with high quality. Then we used them to comprehensive analyses such as genome sequencing or epi-genome sequencing. Through these analyses, we aim for elucidating the oncogenesis or for developing newly treatment strategies of each cancer.

  Study JGAS000303

• RNA-sequencing of ex vivo exhausted human antigen-specific T cells

  Tumor-specific T cells are frequently exhausted by chronic antigenic stimulation. To explore new pathways for reinvigoration of anti-tumor immune functions, we developed a human ex vivo exhaustion model by repetitive antigenic stimulation of primary CD8 T cells. This results in T cells that resemble patient-derived T cells in tumors on a phenotypic and transcriptional level.

  Study EGAS00001006794

• RNA sequencing of CAR-T cells with CD38-CD73-Tim-3-HLA-DR+ phenotype and others in infusion products of tisagenlecleucel for B-cell precursor acute lymphoblastic leukemia

  We enrolled 19 patients with BCP-ALL who took tisagenlecleucel, and infusion products and patient samples were obtained before and after CAR-T infusion. Single-cell analysis by CyTOF revealed that central memory CAR+ T cells increased in long-term responders, whereas PD-1highCD38highCXCR3+ effector CAR+ T cells were enriched in relapsed patients after CAR-T infusion. Furthermore, in long-term responders, CAR+ T cells obtained from infusion products were enriched with CD38-CD73-Tim-3-HLA-DR+ phenotype, and characterized by decreased ability to produce adenosine, and they showed more memory-like transcriptomic characteristics. We elucidated the characteristics of tisagenlecleucel related to a durable response, which could contribute to improving the clinical outcome.

  Study JGAS000760

• minION fastq files of 10 different tumor samples from the Master program (H021)

  Nanopore RNA Sequencing was done for 10 tumor samples. Direct cDNA sequencing was performed using the SQK-DCS109 kit (Oxford Nanopore Technologies). For analysis of a single sample on a MinION flow cell (version R9.4.1), 5 μg RNA was used as input. For multiplexing on a MinION flow cell, 2.5 μg RNA per sample was used as input, and the native barcoding expansion kit EXP-NBD104 was employed in conjunction with SQK-DCS109. After reverse transcription with Maxima H Minus Reverse Transcriptase (Thermo Scientific), second-strand synthesis was performed using the 2x LongAmp Taq Master Mix (New England Biolabs). The resulting double-stranded cDNA was subjected to end-repair and dA-tailing using the NEBNext Ultra End Repair/dA-Tailing Module (New England Biolabs). For multiplexed libraries, this step was followed by barcode ligation and library pooling. Next, libraries were quantified with a Qubit Fluorometer 3.0 (Life Technologies). Finally, sequencing adapters were added to the library preparations and ligated with Blunt/TA Ligase Master Mix (New England Biolabs), followed by further quality control using a Qubit. Samples ACC1 and ACC2 were analyzed on individual MinION flow cells, while the remaining eight samples were sequenced as multiplexed libraries on two MinION flow cells by pooling four samples for each run. Five ACC samples were also analyzed individually on Flongle flow cells

  Dataset EGAD00001008970

• RNA sequencing of periprostatic fat after a 6 month deep androgen deprivation therapy

  Androgen deprivation therapy treated patients (n=11) were recruited from an open label neoadjuvant phase II study in which patients with high-risk disease received a ‘supercastration’ regimen consisting of degarelix 240/80 mg subcutaneously every four weeks; abiraterone acetate 500 mg orally daily titrating upwards every two weeks by 250 mg to a final dose of 1000 mg daily; bicalutamide 50 mg orally daily; and prednisolone 5 mg orally twice daily for a total of 6 months (Australian New Zealand Clinical Trials Registry 12612000772842). Untreated patients with similar pre-treatment characteristics were obtained from a prospective prostatectomy biorepository22,23. Prior to ligation of the dorsal venous complex and prostate pedicles, the anterior prostate was defatted and the specimen was removed immediately, placed in a sterile container and transferred on ice for long-term storage in the vapour phase of liquid nitrogen. A total of 50–100 µg of adipose tissue was separated from fresh frozen samples stored at −160°C. RNA was isolated using the Qiagen RNeasy Lipid Tissue Mini Kit and eluted in 35 µL nuclease-free water. 0.5–1 µg of total RNA was used as the input for cDNA library synthesis using TruSeq RNA Sample Prep Kit v2 (Illumina), and libraries were constructed according to manufacturer’s instructions. Samples were sequenced on a HiSeq 2500 (Illumina) using 101 base paired-end chemistry, aiming for 50 million mapped paired-end reads per sample.

  Dataset EGAD00001004971

• The Role of CDX2 in Controlling ABCB1 Expression and Chemosensitivity in Human Colon Cancer

  This study reports the results of RNA sequencing (RNA-seq) experiments performed on two human colon cancer cell lines (HT-29, DLD-1) that were genetically engineered to achieve either the constitutive expression (in HT-29 cells) or the selective inactivation (in DLD-1 cells) of the transcription factor CDX2, a master regulator of embryonic gut development and a key regulator of multi-lineage differentiation in adult colon epithelial cells. Our previous studies had identified lack of CDX2 expression as a prognostic biomarker of poor prognosis and a predictive biomarker of benefit from adjuvant chemotherapy in Stage-II and Stage-III colon cancer patients (Dalerba et al., NEJM, 374:211-222, 2016; PMID: 26789870). The molecular basis of these associations, however, remained poorly understood. The present study was designed to identify which genes are under the transcriptional control of CDX2, in order to clarify their role in shaping colon cancer resistance to chemotherapy. Of the two lines included in this study, the first (HT-29) is CDX2-negative at baseline, and was infected with a lentivirus vector encoding for the cDNA of the human CDX2 gene under the control of a constitutive promoter (CMV). The second line (DLD-1) is CDX2-positive at baseline, and was infected with a series of lentivirus vectors encoding for CRISPR/Cas9 constructs designed to selectively inactivate the CDX2 gene. In both cases, infected cells were purified by fluorescence-activated cell sorting (FACS), based on the differential expression of a green fluorescent reporter (EGFP) that was also encoded by the lentivirus vectors, and transcribed in tandem with either the CDX2 cDNA (HT-29) or CRISPR/Cas9 gRNAs targeting CDX2 (DLD-1). The experiments were designed to include 3 experimental replicates per condition, and to compare the transcriptional profile of genetically engineered cells with that of autologous controls (i.e., HT-29 cells infected with an "empty" version of the same lentivirus vector used to over-express CDX2, DLD-1 cells engineered with a "non-targeting" CRISPR/Cas9 gRNA). In the specific case of DLD-1 cells engineered with CRIPSR-Cas9 constructs targeting CDX2, infected cells were sorted based on the differential expression of EGFP and then plated as single-cells, in order to sub-culture three isogenic clones, all of which were genetically sequenced to confirm bi-allelic knock-out of the CDX2 gene, and confirmed to lack CDX2 protein expression by Western blot. The results of our experiments demonstrate that, in human colon epithelial cells, CDX2 controls the expression of the ABCB1 efflux pump, by positively regulating the transcription of the corresponding gene.

  Study phs002903

• Covacta RNAseq counts

  RNA-seq data from PAXgene extracted whole blood of patients enrolled in the COVACTA trial. This dataset includes read counts per gene. Read counts were generated for the Gencode v27 annotation using the summarize Overlaps method from bioC in mode “IntersectionStrict”

  Dataset EGAD00001011164

• Whole exome and Transcriptome sequencing of treatment-naïve esophageal adenocarcinoma biopsies and matched peripheral blood mononuclear cells

  Exome sequencing was performed on n=28 treatment-naïve esophageal adenocarcinoma (EACs). Three to four biopsies sampling different areas of each tumor were pooled before nucleic acid extractions to mitigate the elevated heterogeneity described for EAC. WES was performed on EAC biopsies at 120X average coverage, with autologous PBMCs used as germline controls at 80X average coverage. Libraries were prepared from 30 ng of input DNA using the SureSelect QXT Human All Exon V7 kit (Agilent Technologies) and sequenced on the NextSeq 550 (Illumina), 2x150 bp. BCL files were demultiplexed to FastQ files using bcl2fastq2 software (Illumina). Three paired end sequencing batches were analyzed independently (Batch1: samples 8, 10, 11, 12, 15, 17, 18; Batch2: samples 20, 24, 25, 26, 27, 29, 30, 31, 33, 34 ; Batch3: samples 35, 37, 39, 40, 41, 43, 45, 48, 54, 55, 57). RNA sequencing was performed on n=26 treatment-naïve esophageal adenocarcinoma (EACs). Three to four biopsies sampling different areas of each tumor were pooled before nucleic acid extractions to mitigate the elevated heterogeneity described for EAC. RNAseq libraries were prepared on 50 ng of total RNA (with RNA integrity index RIN >=7) with the TruSeq Stranded mRNA library preparation kit (Illumina) in accordance with low-throughput protocol. After PCR enrichment (15 cycles) and purification of adapter-ligated fragments, the concentration and length of DNA fragments were measured using D1000 Screen Tape System (Agilent), obtaining a median insert size of 311 nucleotides. Then, RNAseq libraries were sequenced using the Illumina NovaSeq platform, 1x100 bp, obtaining on average 100 million single reads per sample.

  Dataset EGAD00001010876

• Genomic Characterization CS-MATCH-0007 Arm N

  The CS-MATCH-0007 protocol is part of a collaboration between the Center for Cancer Genomics (CCG) and the Division of Cancer Treatment and Diagnosis (DCTD) to perform whole-exome sequencing, RNA sequencing and if possible, whole-genome, methylation and miRNA sequencing using pre-and post-treatment tumor biopsy specimens from patients enrolled on a treatment arm of the NCI-MATCH clinical trial (EAY131). The goal of this study is to identify the molecular basis for response and resistance to targeted therapies that are matched to specific genomic alterations found in their cancers. Arm N is one of the treatment sub-protocols within the NCI-MATCH Clinical Trial (EAY131) where patients with PTEN mutation, or deletion with PTEN expression on IHC, are treated with the drug GSK2636771. This subprotocol is one of the treatment arms included in the CS-MATCH-0007 protocol and will provide specimens for the program including DNA from tumor tissue and whole blood.

  Study phs002151

• NIDCD Otitis Media Genetic Susceptibility and Middle Ear Microbial Shifts

  The study funded by R01 DC015004 aims to: (1) Identify rare OM susceptibility variants within families and in probands; and (2) Identify differences in the middle ear microbiome due to OM susceptibility variants. This study will also elucidate mechanisms responsible for the formation and growth of cholesteatoma, and bony erosion and complications due to cholesteatoma e.g. intracranial, hearing/vestibular loss, facial nerve palsy. A better understanding of cholesteatoma pathogenesis will potentially reveal novel drug targets, which can lead to new non-surgical therapies for cholesteatomatous OM. Our specific aims for this administrative supplement are: Aim 1 -- Perform RNA-sequencing using cholesteatoma samples collected from Filipino and Colorado patients who will be screened for FUT2, SPINK5 and A2ML1 variants; and Aim 2 -- Using network analysis, identify bone-expressed proteins potentially interacting with FUT2, SPINK5 or A2ML1, then test protein expression in archival human temporal bone in direct contact with cholesteatoma.

  Study phs001941

• Identification and Characterization of Skin-Resident Memory T cells in Patients with Melanoma-Associated Vitiligo

  Metastatic melanoma patients who develop melanoma-associated vitiligo, an autoimmune cutaneous side effect after receiving immunotherapy, have better overall survival than those who do not develop vitiligo. The objective of this study is to determine the tumor-specific memory T cell responses in the skin, tumor and blood of melanoma patients with vitiligo. Matched melanoma tumor, distant vitiligo-affected skin, and blood were collected and sorted for T cells to perform paralleled single-cell RNA sequencing (scRNA-seq) and single-cell TCR sequencing (scTCR-seq) on the day of tissue collection. The transcriptional analysis identified three resident memory T (TRM) cell subsets which were shared between tumors and vitiligo-affected skin. scRNA-seq identified CD8+ T-cell clonotypes in tumors that co-existed as TRM in skin and as effector memory T (TEM) cells in blood. This study revealed that long-term melanoma survivors maintained memory T cell responses as broadly-distributed TRM and TEM compartments. 

  Study phs002309

• A Comprehensive Platform for Analyzing Longitudinal Multi-Omics Data

  PALMO (Platform for Analyzing Longitudinal Multi-omics data) is a platform for analyzing longitudinal data from bulk as well as single cell. It allows to identify inter-, intra-donor variations in genes over longitudinal time points. The analysis can be done on bulk expression dataset without known cell type information or single cell with cell type or user defined groups. It allows to infer stable and variable features in a given donor and each cell type or a user defined group. The outlier analysis can be performed to identify technical/biological perturbed samples in a donor or a participant. Further, differential analysis can be performed to decipher time-wise changes in gene expression in a cell type. The data that is available in the dbGaP is the demo longitudinal samples used in the study, which includes hashed raw fastq files for single-cell RNA-sequencing (scRNA-seq) and non-hashed fastq files for single-cell ATAC-sequencing (scATAC) experiment.

  Study phs003203

• Immune Response to Life-Threatening Respiratory Infections in Children and Young Adults

  This is a cross sectional study describing age-related differences in the nasal mucosal immune response to SARS-CoV-2. We collected nasal mucosal samples from six groups: healthy children, children infected with SARS-CoV-2, children infected with respiratory syncytial virus, children infected with influenza virus, healthy adults, and adults infected with SARS-CoV-2. Samples were obtained by mucosal scrape biopsy of the inferior turbinate using a sterile plastic curette. We performed bulk RNA-sequencing to obtain gene expression data. Clinical data was extracted from the electronic health record including: demographics, medical history, clinical presentation, duration of symptoms, intensive care unit admission, hospital and intensive care unit length of stay, type and duration of respiratory support at sample collection and peak illness. Our analysis described the host response to SARS-CoV-2 in the nasal mucosa in children and adults and compared it to the host response to respiratory syncytial virus and influenza virus.

  Study phs002579