19246 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 31.40 milliseconds.

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• WES sequencing data from 8 classical Hodgkin Lymphoma tumors and 8 corresponding normal samples

  To delineate the mutational landscape of classical Hodgkin Lymphoma Whole Exome sequencing (WES) was performed on HRS cells isolated from classical Hodgkin Lymphoma tumors and corresponding normal samples (n=8)

  Dataset EGAD50000002164

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• CRC cell line MPRA

  Massively Parallel Reporter Assays (MPRA) of colorectal cell lines HCEC-1CT (normal colon) and HT29 and SW403 (MSS cancer). Probes identified using the CRC GWAS.

  Dataset EGAD50000000596

• Single-cell RNA and TCR-sequencing of treatment-refractive immune-mediated arthritis

  Single-cell RNA and TCR-sequencing of three patients with treatment-refractive immune-mediated arthritis. The dataset consists of synovial tissue CD4+ and CD8+ T cells and peripheral blood CD45+ leukocytes.

  Dataset EGAD50000000749

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• scRNA-seq and scTCR-seq from 7 MF patients

  Dataset containing scRNA and scTCR sequencing of 7 patients with cutaneous T cell lymphoma. Sequencing was performed on Illumina NextSeq 550, HiSeq 4000 and NovaSeq 6000. The sequencing was always paired.

  Dataset EGAD50000000332

• CSF and PBMC scRNAseq RRMS patients at diagnostic n=5

  To get insights about immune cells infiltrating cells the CSF of RRMS patients (n=5), we proceed to 10X scRNAseq of paired CSF and blood circulating cells (about 20000 cells each) sampled at diagnostic.

  Dataset EGAD50000000445

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• thraruk-G-1

  Resolving the Genetic Architecture of Aseptic Loosening After Total Hip Replacement

  Dataset EGAD00010001289

• MEC/SEF DNA-seq

  DNA sequencing of 27 MEC/SEF tumor samples. Whole exome sequencing was performed at Beijing Genomics Institute using a library preparation based on Agilent V6(60M). Sequencing was performed on the DNBseq platform sequencer with a read length of 100PE, producing ~12G raw data per sample.

  Dataset EGAD50000000762

• Plasma cell-free whole genome sequencing

  This dataset contains whole genome sequencing data generated from plasma cell-free DNA of metastatic breast cancer patients and healthy individuals. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002524

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Primary plasma cell leukemia genomic abnormalities

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 20 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001004323

• To determine the genomic profile of Triple Negative Breast Cancer patient-derived xenografts (PDX cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (PDX_WGS)

  Study EGAS00001005995

• RNA-Seq data of VDH15 cells with and without deletion of NSUN3

  paired RNA-Seq data of VDH15 cells with and without deletion of NSUN3. The 11 samples were sequenced on HiSeq 4000 and prepared with SmarTer low input RNA and Chip NEBNext kit.

  Dataset EGAD00001006560