3934 results for "RNA AND sequencing OR transcriptome"

in 14.79 milliseconds.

• Single-Cell Analysis of Human Adipogenesis

  The data in this study consists of RNA sequencing reads and read counts from single-cell and single-nuclei RNA sequencing experiments performed on two cell lines to investigate the transcriptional landscape of human adipogenesis in both the brown and white adipose tissue lineage. The two cell lines are human preadipocytes collected and isolated from a defined anatomical location in the neck of a single individual. This depot is known to harbor white adipose tissue (WAT) and brown adipose tissue (BAT). These white and brown preadipocytes were immortalized for the purposes of studying human adipogenesis in vitro. In this study we induced differentiation of these two preadipocyte lines and performed RNA sequencing on over 135,000 single cells spanning a 20-day time course from unperturbed preadipocytes to mature adipocytes from both brown and white lineages. Additionally, we performed both single-cell and single-nuclei RNA sequencing to comprehensively compare the advantages and disadvantages of either technique.

  Study phs002461

• FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls.

  FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls. The POP study placental biopsies were collected within 30 minutes of birth and flash frozen in RNAlater (ThermoFisher). For each biopsy, total placental RNA was extracted from approximately 5 mg of tissue using the “mirVana miRNA Isolation Kit” (Ambion) followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments. RNA-libraries were prepared from 1g of total placental RNA with the TruSeq Stranded mRNA Library Prep Kit (Illumina) which captures polyA-tailed transcripts by oligo-dT beads, then pooled and sequenced (single-end, 50bp) using a Single End V4 cluster kit and Illumina HiSeq2500

  Dataset EGAD00001006304

• Alpha synucleinopathy spectrum - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=44 samples. Tissue samples correspond to patients with different alpha synucleinopathies. Specifically, idiopathic Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=11). RNA seq was carried out using ribosomal depletion. The totality of these samples were also sequenced using single nucleus RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000430

• Alpha synucleinopathy spectrum - single nucleus RNA seq of prefrontal cortex

  Single nucleus RNA seq dataset from prefrontal cortex of a total of N=46 individuals with alpha synucleinopathies and healthy controls. Tissue samples correspond to patients with Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=13). RNA seq was carried out employing 10X Genomics Chromium. These samples were also sequenced using conventional bulk tissue RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000431

• Complex-I stratification of Parkinson's disease - single nucleus RNAseq

  Single nucleus RNA seq dataset for CI stratification of Parkinson's disease Single nucleus RNA seq dataset of prefrontal cortex tissue from a total of N=18 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=12) and neurologically healthy controls (N=6). Single nucleus RNA seq was carried out using 10X Genomics Chromium. This dataset corresponds to a subset of the samples sequenced using conventional bulk tissue RNA seq and available within this Study as a separate Dataset.

  Dataset EGAD50000000432

• Complex-I stratification of Parkinson's disease in the prefrontal cortex - bulk RNA seq

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=98 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=79) and neurologically healthy controls (N=19). RNA seq was carried out using ribosomal depletion. A subset of these samples was additionally sequenced using single nucleus RNA seq and is available in the same Study as an additional Dataset.

  Dataset EGAD50000000433

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• cHCC-ICC RNAseq

  The RNA-seq data of 97 tumor samples from 77 cHCC-ICC cases, data of two other HCC tumor samples were also included.

  Dataset EGAD00001005182

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604