11762 results for "cancer rna-seq"

in 14.25 milliseconds.

• Single nucleus RNA Seq of LUAD patient derived lung samples

  Fastq files of single nucleus RNA Sequencing data from 26 patients including 26 lung adenocarcioma and 12 matched healthy tissue samples for 8 young female never smokers, 8 young female smokers, 7 elderly female never smokers and 3 male never smokers.

  Dataset EGAD00001008955

• RNAseq of human fetal pancreas development

  The dataset comprises RNA-seq information of 4 subpopulations sorted from human fetal pancreas of 3 different donors. Low input libraries were generated using the Smart-seq2 protocol after Ampure XP cleanup of the total RNA extracted from the sorted cells. Libraries were multiplexed and sequenced paired-end over 2 lanes of HiSeq4000 each. Raw data was aligned to the human genome refernence GRCh37 using STAR v2.5.1b with GENCODE v19 as transcriptome reference, and unaligned reads were folded into the final uploaded bams.

  Dataset EGAD00001004210

• RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells

  RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells. RNAseq was performed using 200 ng of total RNA by GATC Biotech. Directional libraries were performed after mRNA selection by polyA selection using UTP method. RNA-seq libraries were sequenced on HiSeq2500 Illumina machine using 100bp paired-end reads. Reads alignment was performed using the STAR aligner (version 2.4.0f1) and human genome hg19 as reference.

  Dataset EGAD00001007813

• Clonal Evolution and Heterogeneity of Osimertinib Acquired Resistance Mechanisms in EGFR Mutant Lung Cancer

  Current understanding of acquired resistance to osimertinib in EGFR-mutant lung cancer is largely based on the use of targeted sequencing platforms and cell-free DNA. In this study we examined the clonal evolution and heterogeneity of acquired resistance mechanisms to osimertinib through whole exome and RNA-sequencing of prospectively collected pre-and post-osimertinib resistant tumors and metastases at rapid autopsy. We enrolled 34 patients with histologically confirmed EGFR mutant advanced lung adenocarcinoma in a prospective Phase II clinical trial to evaluate osimertinib treatment and the use of local ablative therapy (LAT) for oligoprogressive disease (NCT02759835) in EGFR mutant NSCLC from April 2016 until data cutoff in September 2019. Patients were not selected based on oligometastatic status, rather 32/34 patients had multiple organ involvement, including lung, liver, adrenal, brain and bone. Biopsies or surgeries were performed pre-osimertinib treatment and at first progression on osimertinib. A subset of patients also underwent biopsies at second progression on osimertinib, and following end of life in-patient hospice and rapid autopsy upon death. 63% (n=15/24) of first-line osimertinib and 50% (n=5/10) of second-line osimertinib treated patients had RECIST defined partial response. Overall, 21 patients had RECIST defined first progression on osimertinib. Two patients on this trial discontinued treatment and were lost to follow up. Of the 21 patients who had RECIST defined progression, 14 patients underwent LAT (8 first-line and 6 second-line). Twelve patients had paired pre- and post-osimertinib resistant tumors and three had post-osimertinib resistant tumors available for analysis. Four patients (LAT002, LAT006, LAT014 and LAT021) consented for a rapid autopsy protocol and underwent rapid autopsy after deatH. To elucidate acquired osimertinib resistance mechanisms, we performed whole-exome (WES), targeted sequencing and RNA-seq on 66 tumors and matched germline DNA from tumor tissue obtained from a total of 15 patients.

  Study phs002001

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: LIRI-JP.

  Dataset EGAD00001003547

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: CLLE-ES.

  Dataset EGAD00001003548

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: CLLE-ES.

  Dataset EGAD00001003549

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: RECA-EU.

  Dataset EGAD00001003559

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: PACA-AU.

  Dataset EGAD00001003410

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: PACA-AU.

  Dataset EGAD00001003411

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: MALY-DE.

  Dataset EGAD00001003560

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: MALY-DE.

  Dataset EGAD00001003561

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: RECA-EU.

  Dataset EGAD00001003558

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: OV-AU.

  Dataset EGAD00001003415

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: OV-AU.

  Dataset EGAD00001003416