15080 results for "cancer studies using rna-seq"

in 17.62 milliseconds.

• Multi-omic analysis of the tumor microenvironment shows clinical correlations in Ph1 study of atezolizumab +/- SoC in MM

  Multiple myeloma (MM) remains incurable, and treatment of relapsed/refractory (R/R) disease is challenging. There is an unmet need for more targeted therapies in this setting; deep cellular and molecular phenotyping of the tumor and microenvironment in MM could help guide such therapies. This phase 1b study (NCT02431208) evaluated the safety and efficacy of the anti-programmed death-ligand 1 monoclonal antibody atezolizumab (Atezo) alone or in combination with the standard of care (SoC) treatments lenalidomide (Len) or pomalidomide (Pom) and/or daratumumab (Dara) in patients with R/R MM. Study endpoints included incidence of adverse events (AEs) and overall response rate (ORR). A novel unsupervised integrative multi-omic analysis was performed using RNA sequencing, mass cytometry immunophenotyping, and proteomic profiling of baseline and on-treatment bone marrow samples from patients receiving Atezo monotherapy or Atezo+Dara. A similarity network fusion (SNF) algorithm was applied to preprocessed data. Eighty-five patients were enrolled. Treatment-emergent deaths occurred in 2 patients; both deaths were considered unrelated to study treatment. ORRs ranged from 11.1% (Atezo+Len cohorts, n=18) to 83.3% (Atezo+Dara+Pom cohort, n=6). High-dimensional multi-omic profiling of the tumor microenvironment and integrative SNF analysis revealed novel correlations between cellular and molecular features of the tumor and immune microenvironment, patient selection criteria, and clinical outcome. Atezo monotherapy and SoC combinations were safe in this patient population and demonstrated some evidence of clinical efficacy. Integrative analysis of high dimensional genomics and immune data identified novel clinical correlations that may inform patient selection criteria and outcome assessment in future immunotherapy studies for myeloma.

  Study EGAS00001007286

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• RNA sequencing of periprostatic fat after a 6 month deep androgen deprivation therapy

  Androgen deprivation therapy treated patients (n=11) were recruited from an open label neoadjuvant phase II study in which patients with high-risk disease received a ‘supercastration’ regimen consisting of degarelix 240/80 mg subcutaneously every four weeks; abiraterone acetate 500 mg orally daily titrating upwards every two weeks by 250 mg to a final dose of 1000 mg daily; bicalutamide 50 mg orally daily; and prednisolone 5 mg orally twice daily for a total of 6 months (Australian New Zealand Clinical Trials Registry 12612000772842). Untreated patients with similar pre-treatment characteristics were obtained from a prospective prostatectomy biorepository22,23. Prior to ligation of the dorsal venous complex and prostate pedicles, the anterior prostate was defatted and the specimen was removed immediately, placed in a sterile container and transferred on ice for long-term storage in the vapour phase of liquid nitrogen. A total of 50–100 µg of adipose tissue was separated from fresh frozen samples stored at −160°C. RNA was isolated using the Qiagen RNeasy Lipid Tissue Mini Kit and eluted in 35 µL nuclease-free water. 0.5–1 µg of total RNA was used as the input for cDNA library synthesis using TruSeq RNA Sample Prep Kit v2 (Illumina), and libraries were constructed according to manufacturer’s instructions. Samples were sequenced on a HiSeq 2500 (Illumina) using 101 base paired-end chemistry, aiming for 50 million mapped paired-end reads per sample.

  Dataset EGAD00001004971

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML

  Background Massively parallel sequencing technology has transformed cancer genomics. It is now feasible, in a clinically relevant time-frame, for a clinically manageable cost, to screen DNA from patient tumours for mutations essentially genome-wide. The challenge for personalised medicine will be to increase the sample size to thousands or tens of thousands of well-characterised cases in order to attain sufficient statistical power to stratify patients accurately across the complexity and genomic heterogeneity expected for most of the common tumour types. Currently, whole genome sequencing on this scale is not feasible, and targeted sequencing of relevant portions of the genome will be required. Pilot data We have developed protocols for large-scale, multiplexed sequencing of 100-200 genes in thousands of samples. Essentially, using robotic technology, genomic DNA from the cancer specimen is processed into sequencing libraries with unique DNA barcodes, thereby allowing sequencing reads to be attributed to the sample they derive from. Currently, these sequencing libraries can be generated in a 96-well format using fully automated protocols, and we are exploring methods to expand this to a 384-well format. The sequencing libraries are pooled and hybridized to custom sets of RNA baits representing the genomic regions of interest. Sequencing of the pulled-down libraries is done in pools of 48-96 samples per lane of an Illumina Hi-Seq. This protocol is already implemented at the Sanger Institute. We have published proof that somatic mutations in novel cancer genes can be identified from exome-wide sequencing. In unpublished pilot data, we have established the feasibility of robotic library production, custom pull-down, and multiplexed sequencing of barcoded libraries for 100 known myeloid cancer genes across 760 myelodysplasia samples. Highlights of the data thus far analysed reveal that the coverage is remarkably even between samples; when 96 samples are run, average coverage per lane of sequencing is ~250, with 90-95% of targeted exons covered by >25 reads; known mutations can be discovered in the data set; and the protocol is amenable to whole genome amplified DNA. The bioinformatic algorithms for identification of substitutions and indels in pull-down data are well-established; we have pilot data proving that copy number changes, LOH and genomic rearrangements in specific regions of interest can also be identified by tiling of baits across the relevant loci. Proposal We propose to apply this methodology to 10000 samples from patients with AML enrolled in clinical trials over the last 10-20 years. Oncogenic point mutations and potentially genomic rearrangements will be identified, and linked to clinical outcome data, with a view to undertaking the following sorts of analyses: • Identification of co-occurrence, mutual exclusivity and clusters of driver mutations. • Correlation of prognosis with driver mutations and potentially gene-gene interactions • Exploration of genomic markers of drug response Ultimately, we would like to be in a position to release the mutation data together with matched clinical outcome data to genuine medical researchers via a controlled access approach, possibly within the COSMIC framework (www.sanger.ac.uk/genetics/CGP/cosmic/). The vision here is to generate a portal whereby a clinician faced with an AML patient and his / her mutational profile can obtain a ‘personalised’ prediction of outcome, together with a fair assessment of the uncertainty of the estimate. With a sufficient sample size, there would also be the potential to develop decision support algorithms for therapeutic choices based on such data.

  Study EGAS00001000408

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Megabase-scale Haplotyped Genomic Analysis of Normal and Cancer Genomes

  We experimentally determined Mb-scale haplotypes from germline and cancer genome sequencing. Using a microfluidic process that partitions long DNA fragments into hundreds of thousands of barcoded reactions, we determined haplotype blocks from matched colorectal cancer samples in the delineation of haplotypes of allelic imbalances and other genomic instability events.

  Study phs000898

• Targeted_Pulldown_Validation_of_mutations_found_in_whole_genome_sequencing

  This experiment is to inform us of the validity of using pre-made library material to perform a bespoke pulldown experiment to validate the mutations found between the whole genome sequencing of the DNA from the same individuals cancer and normal material. This is to identify the valid and informative mutations in cancer genomes.

  Study EGAS00001000260

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• ChiLDReN/BA: Genetic Studies of Biliary Atresia in the Childhood Liver Disease Research Network

  Biliary atresia (BA) is a progressive necroinflammatory process initially involving the extra-hepatic biliary tree. Little is known about the factors that cause BA or the factors that influence disease progression. A variety of genetic, autoimmune, and environmental influences have been hypothesized to be important. Most studies to date have focused on the neonate and young child with BA, yet the older surviving child with BA can provide important information about genetics as well as natural history.The Childhood Liver Disease Research Network (ChiLDReN) conducts two longitudinal and observational studies that include BA patients: Biliary Atresia Study in Infants and Children (BASIC) and A Prospective Database of Infants with Cholestasis (PROBE). Using samples from participants in these two protocols, we have formed the largest known data set of biliary atresia patients in the world. ChiLDReN is performing a series of genomic analyses, with subsequent analyses being released as subsequent versions of this registration, phs003356. Version 1 concerns PKD1L1.About the PKD1L1 Analysis (phs003356.v1): While multiple factors have been implicated in the perinatal biliary injuries that characterize BA, a definitive etiology has not yet been established. This study is part of a larger project to characterize the largest cohort of pediatric BA patients through whole-exome sequencing (WES). In this analysis, we examine the WES of those with various laterality defects to determine whether genetic factors could be identified to explicate the etiopathogenesis of BA in biliary atresia splenic malformation (BASM) syndrome. We specifically explored variations in the PKD1L1 gene, which recently has been identified in mouse models as playing a role in laterality.

  Study phs003356

• Targeted NGS panel

  The mutational status of 121 genes recurrently altered in B-cell lymphoma was examined in 55 of 56 diagnostic and 10 of 12 relapse samples using a custom targeted NGS panel. Libraries were generated from 150 ng of DNA using molecular-barcoded library adapters (ThruPLEX Tag- seq kit; Takara) coupled with a custom hybridization capture-based method (SureSelectXT Target Enrichment System Capture strategy, Agilent Technologies). The quality of the libraries was determined using the Bioanalyzer high sensitivity DNA kit (Agilent) and quantified by PCR using the KAPA library quantification kit (KAPA Biosystems). Finally, the libraries were pooled and sequenced in the MiSeq instrument (Illumina).

  Dataset EGAD00001010842

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• Investigation of Brain Nitrogen Metabolism in Partial Ornithine Transcarbamylase Deficiency (OTCD) Using 1H MRS, DTI, and fMRI

  This is a case controlled, observational study. This project studies cognitive and motor dysfunction in adult and pediatric patients who are female carriers of ornithine transcarbamylase deficiency (OTCD) or are males with late onset presentation (outside of the newborn period) of OTCD, utilizing state of the art MRI (magnetic resonance imaging), a non-invasive technique. This project seeks to improve our understanding of the underlying neural mechanisms that contribute to metabolic, cognitive, sensory and motor abnormalities in urea cycle disorders, which although individually rare, collectively constitute a major cause of neonatal encephalopathy, leading to significant morbidity and mortality. As a result of this study, a greater understanding of the anatomic, cognitive, motor, and biochemical underpinnings of neurologic damage attributable to this metabolic disorder will be gained. Experimental approaches will combine sensory, cognitive and motor testing with structural, functional and molecular magnetic resonance imaging to study symptomatic and asymptomatic heterozygous female carriers of X-linked ornithine transcarbamylase deficiency (OTCD), and late onset hemizygous males. Participants to be included in the studies ranged from ages 7-60 years and were compared to an age-matched typically developed (TD) comparison group. For our research, we use anatomic MRI, functional Magnetic Resonance Imaging (fMRI), and magnetic resonance spectroscopy (MRS) to monitor brain activity. The technique of fMRI provides detailed maps of the brain areas underlying human mental activities. By using fMRI, we are able to observe how the brain is functioning while a person is performing a specific task, such as reading. We can not only observe differences in the structure of the brain, but can also measure differences in brain function and activity as well. This information will ultimately be used to provide a basis for designing more effective interventions and methods for early identification of learning disabilities in patients with OTCD and related disorders. We will also use MRS to study various brain chemicals such as glutamine using the non-invasive MRI imaging techniques.

  Study phs001296

• Genome-wide cell-free DNA termini in patients with cancer

  The structure, fragmentation pattern, length and terminal sequence of cell-free DNA (cfDNA) is under the influence of nucleases present in the blood. We hypothesized that differences in the diversity of bases at the end of cfDNA fragments can be leveraged on a genome-wide scale to enhance the sensitivity for detecting the presence of tumor signals in plasma. We surveyed the cfDNA termini in 72 plasma samples from 319 patients with 18 different cancer types using low-coverage whole genome sequencing. The fragment-end sequence and diversity were altered in all cancer types in comparison to 76 healthy controls. We converted the fragment end sequences into a quantitative metric and observed that this correlates with circulating tumor DNA tumor fraction (R = 0.58, p < 0.001, Spearman). Using these metrics, we were able to classify cancer samples from control at a low tumor content (AUROC of 91% at 1% tumor fraction) and shallow sequencing coverage (mean AUROC = 0.99 at >1M fragments). Combining fragment-end sequences and diversity using machine learning, we classified cancer from healthy controls (mean AUROC = 0.99, SD = 0.01). Using unsupervised clustering we showed that early-stage lung cancer can be classified from control or later stages based on fragment-end sequences. We observed that fragment-end sequences can be used for prognostication (hazard ratio: 0.49) and residual disease detection inresectable esophageal adenocarcinoma patients, moving fragmentomics toward a greater clinical implementation.

  Study EGAS00001005738

• Genome-wide cell-free DNA termini in patients with cancer

  The structure, fragmentation pattern, length and terminal sequence of cell-free DNA (cfDNA) is under the influence of nucleases present in the blood. We hypothesized that differences in the diversity of bases at the end of cfDNA fragments can be leveraged on a genome-wide scale to enhance the sensitivity for detecting the presence of tumor signals in plasma. We surveyed the cfDNA termini in 72 plasma samples from 319 patients with 18 different cancer types using low-coverage whole genome sequencing. The fragment-end sequence and diversity were altered in all cancer types in comparison to 76 healthy controls. We converted the fragment end sequences into a quantitative metric and observed that this correlates with circulating tumor DNA tumor fraction (R = 0.58, p < 0.001, Spearman). Using these metrics, we were able to classify cancer samples from control at a low tumor content (AUROC of 91% at 1% tumor fraction) and shallow sequencing coverage (mean AUROC = 0.99 at >1M fragments). Combining fragment-end sequences and diversity using machine learning, we classified cancer from healthy controls (mean AUROC = 0.99, SD = 0.01). Using unsupervised clustering we showed that early-stage lung cancer can be classified from control or later stages based on fragment-end sequences. We observed that fragment-end sequences can be used for prognostication (hazard ratio: 0.49) and residual disease detection inresectable esophageal adenocarcinoma patients, moving fragmentomics toward a greater clinical implementation.

  Study EGAS00001005747

• Somatic mutation analysis based on Whole exome Sequencing (WES) of multiple tumor biopsies, patient-derived spheroids and leukocyte DNA from colorectal cancer patients (vcf files)

  Somatic mutations were called using whole exome Sequencing (WES) data from colorectal cancer samples (dataset EGAD00001003821) using MuTect2, with matched constitutional WES-data obtained from leukocytes samples as reference.

  Dataset EGAD00001003823

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• minION fastq files of 10 different tumor samples from the Master program (H021)

  Nanopore RNA Sequencing was done for 10 tumor samples. Direct cDNA sequencing was performed using the SQK-DCS109 kit (Oxford Nanopore Technologies). For analysis of a single sample on a MinION flow cell (version R9.4.1), 5 μg RNA was used as input. For multiplexing on a MinION flow cell, 2.5 μg RNA per sample was used as input, and the native barcoding expansion kit EXP-NBD104 was employed in conjunction with SQK-DCS109. After reverse transcription with Maxima H Minus Reverse Transcriptase (Thermo Scientific), second-strand synthesis was performed using the 2x LongAmp Taq Master Mix (New England Biolabs). The resulting double-stranded cDNA was subjected to end-repair and dA-tailing using the NEBNext Ultra End Repair/dA-Tailing Module (New England Biolabs). For multiplexed libraries, this step was followed by barcode ligation and library pooling. Next, libraries were quantified with a Qubit Fluorometer 3.0 (Life Technologies). Finally, sequencing adapters were added to the library preparations and ligated with Blunt/TA Ligase Master Mix (New England Biolabs), followed by further quality control using a Qubit. Samples ACC1 and ACC2 were analyzed on individual MinION flow cells, while the remaining eight samples were sequenced as multiplexed libraries on two MinION flow cells by pooling four samples for each run. Five ACC samples were also analyzed individually on Flongle flow cells

  Dataset EGAD00001008970