15120 results for "cancer studies using rna-seq"

in 15.06 milliseconds.

• Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Dataset EGAD00001015397

• Identification of molecule relationship between intravenous leiomyomatosis and uterus myoma

  Up to now, there are two hypothesis about the pathogenesis of the relationship of intravenous leiomyomatosis and uterine myoma. One theory suggests that the IVL comes from the smooth muscle cell in the vessel wall.The other theory indicates that the IVL derives from the uterine myometrium. However, limited to the technology, few studies have been deeply explore the underlying relation. In this study, we employ the RNA sequencing to explore the molecule relationship between IVL and uterus myoma. In order to identify the molecule relationship between IVl and uterine myoma we conducted transcriptome sequencing and bioinformaitc analysis

  Dataset EGAD00001003356

• The Sea Islands Genetic Network (SIGNET): Identifying genetic contributors to diabetes and dyslipidemia in African Americans

  Recent genome-wide association studies (GWAS) have successfully identified genetic variants that influence diabetes risk in European populations, however most do not have a major impact on diabetes risk in populations of African descent. The African American (AA) population from the Sea Islands of coastal South Carolina and Georgia has high rates of type 2 diabetes, low levels of admixture, and in general, consume a diet rich in saturated fats. We postulate that this unique combination of ancestral and environmental factors results in a more consistent penetrance of diabetes risk alleles, as well as enrichment of risk alleles of African origin. The existing DNA samples and rich phenotypic data from the Sea Island Families Project comprise a unique resource for genetic studies of type 2 diabetes and related metabolic traits such as dyslipidemia. Our central hypothesis is that the increased risk for T2DM in AA compared with European American (EA) is due, in part, to susceptibility alleles of African origin, and that these alleles can be identified using a GWAS. The Specific Aims are to: 1) Identify genetic risk factors for type 2 diabetes utilizing DNA samples and data from the Sea Island Families Project, Reasons for Geographic and Racial Differences in Stroke (REGARDS) Study recruited from SC, GA, NC, and AL; and a GWAS approach; 2) Identify genetic contributors to lipoprotein subclasses in African Americans using the lipoprotein subclass profile (particle size and concentration for multiple subclasses of VLDL, LDL, and HDL) assessed by NMR at LipoScience, Inc., and the GWAS data from Aim 1. The rationale for this project is that identification and validation of novel pathophysiological pathways and informed selection of candidate genes for diabetes risk will inform development of new, targeted prevention and treatment strategies in this underserved, high risk population.

  Study phs000433

• Single molecule genome-wide mutation profiles of cell-free DNA for non-invasive detection of cancer

  Somatic mutations are a hallmark of tumorigenesis and may be useful for non-invasive diagnosis of cancer. We analyzed whole-genome sequencing (WGS) data from 2,511 individuals in the Pan-Cancer Analysis of Whole Genomes (PCAWG) study as well as 489 individuals from four prospective cohorts and found distinct regional and mutation type specific frequencies in tissue and cell-free DNA (cfDNA) of cancer patients that were associated with replication timing and other chromatin features. A machine learning model using genome-wide mutational profiles combined with other features and followed by CT imaging detected >90% of lung cancer patients, including those with stage I and II disease. The fixed model was validated in an independent cohort, detected patients with cancer earlier than standard approaches, and could be used to monitor response to therapy. This approach lays the groundwork for non-invasive cancer detection using genome-wide mutation features that may facilitate cancer screening and monitoring.

  Study EGAS00001007248

• End motifs analysis of circulating DNA from the plasma of patients with stage II-III breast cancer (n=50), stage I-III non-small cell lung cancer (n=56), metastatic colorectal cancer (mCRC) (n=15) and healthy individuals (n=37)..

  We have developed an algorithm designed to discriminate cancer patients and healthy individuals based on cirDNA fragment end motif analysis assisted by machine learning, using data obtained from shallow whole genome sequencing (a method we call EMA). We applied EMA to cirDNA from the plasma of patients with stage II-III breast cancer, stage I-III non-small cell lung cancer, and metastatic colorectal cancer (mCRC). CirDNA from 158 individuals was prepared following the conventional double-stranded DNA library preparation (DSP). We also performed a single-stranded DNA library preparation (SSP) using mCRC patients and healthy control cirDNA, which allowed us to make the first ever end motif analysis in the literature which compares the use of DSP and SSP.

  Study EGAS50000001319

• Genome-wide cell-free DNA biological patterns in patients with cancer

  The structure of cell-free DNA (cfDNA) is altered in the blood of cancer patients. From whole genome sequencing we retrieved the cfDNA fragment-end composition using a new software (FrEIA), as well as the cfDNA size and tumor fraction in three independent cohorts (n=925 cancer from >10 types and 321 control samples). At 95% specificity, we detect 72% of cancer samples using at least one cfDNA measure, including 64% of early-stage cancer (n=220). cfDNA detection correlates with a shorter overall (p=0.018) and recurrence-free (p=0.006) survival in patients with resectable esophageal adenocarcinoma. Integrating cfDNA measures with machine learning in an independent test set (n=396 cancer, 90 controls) achieve a detection accuracy of 82% and AUROC of 96%. In conclusion, harnessing the biological features of cfDNA can improve at no-extra cost the diagnostic performance of liquid biopsies.

  Study EGAS00001007400

• Broad utility of ultrasensitive analysis of ctDNA dynamics across solid tumors treated with immunotherapy

  Prior studies have suggested the biomarker potential of plasma circulating tumor DNA (ctDNA) in cancer patients treated with immune checkpoint inhibitors (ICIs). In order to characterize the potential role of ultrasensitive ctDNA detection in the management of these patients we have performed tumor whole-genome-informed, ultrasensitive ctDNA analysis—tracking approximately 1,800 tumor-specific mutations per patient—in a retrospective cohort (n=136) and a prospective validation cohort (n=66) across 24 cancer types treated with ICIs alone or in combination with bispecific antibodies or immune cell engagers. Analyzing 1,455 longitudinal samples, we found that ctDNA molecular response measured as early as 3 weeks after treatment initiation correlated with improved progression-free and overall survival, while ctDNA clearance at any time strongly correlated with radiological response and prolonged survival. Additionally, ctDNA dynamics distinguished true progression from pseudoprogression and predicted outcomes in patients receiving continued immunotherapy beyond initial progression. This study highlights the broader applicability of ultrasensitive ctDNA as a biomarker across cancer types and immunotherapy modalities.

  Study EGAS50000001333

• scRNA-seq of HSPC treated with gemcitabine and carboplatin

  4 samples of 2000000 HSPCs in 2 ml media each were then prepared and treated for 24 hours: carboplatin-high: 150 µg/ml carboplatin carboplatin-low: 18.75 µg/ml carboplatin gemcitabine: 25 ng/ml gemcitabine control: no drug Single-cells were subsequently extracted using the ddSEQ™ Single-Cell Isolator (Bio-Rad) and later sequenced using the SureCell™ Whole Transcriptome Analysis 3' Library Prep Kit (Illumina) on the NextSeq 500 System (Illumina) using the NextSeq 500/550 High Output Kit v2.5 150 Cycles (Illumina) all following the manufacturer's instructions. The raw FASTQ-files are available as read 1 and read 2 files from 4 lanes for each sample giving a total of 16 FASTQ-files. The FASTQ-files were also processed following the ddSeeker (Romagnoli, D., et al., BMC Genomics 2018, doi:10.1186/s12864-018-5249-x) and Drop-seq (Macosko, E.Z., et al., Cell 2015, doi:10.1016/j.cell.2015.05.002) protocols for processing scRNA-seq data to yield the final digital gene expression (dge) for each cell of each sample. This has resulted in one dge text file and one dge summary text file per sample. These 8 text-files with dge data are found in the zip-compressed analysis data-file.

  Dataset EGAD00001006080

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• RNA sequencing of periprostatic fat after a 6 month deep androgen deprivation therapy

  Androgen deprivation therapy treated patients (n=11) were recruited from an open label neoadjuvant phase II study in which patients with high-risk disease received a ‘supercastration’ regimen consisting of degarelix 240/80 mg subcutaneously every four weeks; abiraterone acetate 500 mg orally daily titrating upwards every two weeks by 250 mg to a final dose of 1000 mg daily; bicalutamide 50 mg orally daily; and prednisolone 5 mg orally twice daily for a total of 6 months (Australian New Zealand Clinical Trials Registry 12612000772842). Untreated patients with similar pre-treatment characteristics were obtained from a prospective prostatectomy biorepository22,23. Prior to ligation of the dorsal venous complex and prostate pedicles, the anterior prostate was defatted and the specimen was removed immediately, placed in a sterile container and transferred on ice for long-term storage in the vapour phase of liquid nitrogen. A total of 50–100 µg of adipose tissue was separated from fresh frozen samples stored at −160°C. RNA was isolated using the Qiagen RNeasy Lipid Tissue Mini Kit and eluted in 35 µL nuclease-free water. 0.5–1 µg of total RNA was used as the input for cDNA library synthesis using TruSeq RNA Sample Prep Kit v2 (Illumina), and libraries were constructed according to manufacturer’s instructions. Samples were sequenced on a HiSeq 2500 (Illumina) using 101 base paired-end chemistry, aiming for 50 million mapped paired-end reads per sample.

  Dataset EGAD00001004971

• Mapping genetic effects on cell type-specific chromatin accessibility using single nucleus ATAC-seq

  Gene regulation is highly cell type-specific and understanding the function of non-coding genetic variants associated with complex traits requires molecular phenotyping at cell type resolution. In this study we performed single nucleus ATAC-seq (snATAC-seq) and genotyping in peripheral blood mononuclear cells from 13 individuals. We mapped chromatin accessibility QTLs (caQTLs) in each immune cell type and sub-type in a subset of 10 samples of European genetic ancestry.

  Study EGAS00001006184

• Multi-omic analysis of the tumor microenvironment shows clinical correlations in Ph1 study of atezolizumab +/- SoC in MM

  Multiple myeloma (MM) remains incurable, and treatment of relapsed/refractory (R/R) disease is challenging. There is an unmet need for more targeted therapies in this setting; deep cellular and molecular phenotyping of the tumor and microenvironment in MM could help guide such therapies. This phase 1b study (NCT02431208) evaluated the safety and efficacy of the anti-programmed death-ligand 1 monoclonal antibody atezolizumab (Atezo) alone or in combination with the standard of care (SoC) treatments lenalidomide (Len) or pomalidomide (Pom) and/or daratumumab (Dara) in patients with R/R MM. Study endpoints included incidence of adverse events (AEs) and overall response rate (ORR). A novel unsupervised integrative multi-omic analysis was performed using RNA sequencing, mass cytometry immunophenotyping, and proteomic profiling of baseline and on-treatment bone marrow samples from patients receiving Atezo monotherapy or Atezo+Dara. A similarity network fusion (SNF) algorithm was applied to preprocessed data. Eighty-five patients were enrolled. Treatment-emergent deaths occurred in 2 patients; both deaths were considered unrelated to study treatment. ORRs ranged from 11.1% (Atezo+Len cohorts, n=18) to 83.3% (Atezo+Dara+Pom cohort, n=6). High-dimensional multi-omic profiling of the tumor microenvironment and integrative SNF analysis revealed novel correlations between cellular and molecular features of the tumor and immune microenvironment, patient selection criteria, and clinical outcome. Atezo monotherapy and SoC combinations were safe in this patient population and demonstrated some evidence of clinical efficacy. Integrative analysis of high dimensional genomics and immune data identified novel clinical correlations that may inform patient selection criteria and outcome assessment in future immunotherapy studies for myeloma.

  Study EGAS00001007286

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741