15128 results for "cancer studies using rna-seq"

in 15.21 milliseconds.

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single-cell characterization of human GBM reveals regional differences in tumor-infiltrating leukocyte activation

  Raw sequencing files from scRNA-seq dataset used in Schmassmann et al. 2023. Single-cell characterization of human GBM reveals regional differences in tumor-infiltrating leukocyte activation. Elife 12 (https://elifesciences.org/articles/92678) Dataset content: 14 samples from 5 donors File type: paired-end fastq files Technology: Illumina sequencing Experimentation used: scRNA-seq using the 10X technology

  Dataset EGAD50000000434

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML

  Background Massively parallel sequencing technology has transformed cancer genomics. It is now feasible, in a clinically relevant time-frame, for a clinically manageable cost, to screen DNA from patient tumours for mutations essentially genome-wide. The challenge for personalised medicine will be to increase the sample size to thousands or tens of thousands of well-characterised cases in order to attain sufficient statistical power to stratify patients accurately across the complexity and genomic heterogeneity expected for most of the common tumour types. Currently, whole genome sequencing on this scale is not feasible, and targeted sequencing of relevant portions of the genome will be required. Pilot data We have developed protocols for large-scale, multiplexed sequencing of 100-200 genes in thousands of samples. Essentially, using robotic technology, genomic DNA from the cancer specimen is processed into sequencing libraries with unique DNA barcodes, thereby allowing sequencing reads to be attributed to the sample they derive from. Currently, these sequencing libraries can be generated in a 96-well format using fully automated protocols, and we are exploring methods to expand this to a 384-well format. The sequencing libraries are pooled and hybridized to custom sets of RNA baits representing the genomic regions of interest. Sequencing of the pulled-down libraries is done in pools of 48-96 samples per lane of an Illumina Hi-Seq. This protocol is already implemented at the Sanger Institute. We have published proof that somatic mutations in novel cancer genes can be identified from exome-wide sequencing. In unpublished pilot data, we have established the feasibility of robotic library production, custom pull-down, and multiplexed sequencing of barcoded libraries for 100 known myeloid cancer genes across 760 myelodysplasia samples. Highlights of the data thus far analysed reveal that the coverage is remarkably even between samples; when 96 samples are run, average coverage per lane of sequencing is ~250, with 90-95% of targeted exons covered by >25 reads; known mutations can be discovered in the data set; and the protocol is amenable to whole genome amplified DNA. The bioinformatic algorithms for identification of substitutions and indels in pull-down data are well-established; we have pilot data proving that copy number changes, LOH and genomic rearrangements in specific regions of interest can also be identified by tiling of baits across the relevant loci. Proposal We propose to apply this methodology to 10000 samples from patients with AML enrolled in clinical trials over the last 10-20 years. Oncogenic point mutations and potentially genomic rearrangements will be identified, and linked to clinical outcome data, with a view to undertaking the following sorts of analyses: • Identification of co-occurrence, mutual exclusivity and clusters of driver mutations. • Correlation of prognosis with driver mutations and potentially gene-gene interactions • Exploration of genomic markers of drug response Ultimately, we would like to be in a position to release the mutation data together with matched clinical outcome data to genuine medical researchers via a controlled access approach, possibly within the COSMIC framework (www.sanger.ac.uk/genetics/CGP/cosmic/). The vision here is to generate a portal whereby a clinician faced with an AML patient and his / her mutational profile can obtain a ‘personalised’ prediction of outcome, together with a fair assessment of the uncertainty of the estimate. With a sufficient sample size, there would also be the potential to develop decision support algorithms for therapeutic choices based on such data.

  Study EGAS00001000408

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• Megabase-scale Haplotyped Genomic Analysis of Normal and Cancer Genomes

  We experimentally determined Mb-scale haplotypes from germline and cancer genome sequencing. Using a microfluidic process that partitions long DNA fragments into hundreds of thousands of barcoded reactions, we determined haplotype blocks from matched colorectal cancer samples in the delineation of haplotypes of allelic imbalances and other genomic instability events.

  Study phs000898

• Targeted_Pulldown_Validation_of_mutations_found_in_whole_genome_sequencing

  This experiment is to inform us of the validity of using pre-made library material to perform a bespoke pulldown experiment to validate the mutations found between the whole genome sequencing of the DNA from the same individuals cancer and normal material. This is to identify the valid and informative mutations in cancer genomes.

  Study EGAS00001000260

• minION fastq files of 10 different tumor samples from the Master program (H021)

  Nanopore RNA Sequencing was done for 10 tumor samples. Direct cDNA sequencing was performed using the SQK-DCS109 kit (Oxford Nanopore Technologies). For analysis of a single sample on a MinION flow cell (version R9.4.1), 5 μg RNA was used as input. For multiplexing on a MinION flow cell, 2.5 μg RNA per sample was used as input, and the native barcoding expansion kit EXP-NBD104 was employed in conjunction with SQK-DCS109. After reverse transcription with Maxima H Minus Reverse Transcriptase (Thermo Scientific), second-strand synthesis was performed using the 2x LongAmp Taq Master Mix (New England Biolabs). The resulting double-stranded cDNA was subjected to end-repair and dA-tailing using the NEBNext Ultra End Repair/dA-Tailing Module (New England Biolabs). For multiplexed libraries, this step was followed by barcode ligation and library pooling. Next, libraries were quantified with a Qubit Fluorometer 3.0 (Life Technologies). Finally, sequencing adapters were added to the library preparations and ligated with Blunt/TA Ligase Master Mix (New England Biolabs), followed by further quality control using a Qubit. Samples ACC1 and ACC2 were analyzed on individual MinION flow cells, while the remaining eight samples were sequenced as multiplexed libraries on two MinION flow cells by pooling four samples for each run. Five ACC samples were also analyzed individually on Flongle flow cells

  Dataset EGAD00001008970

• Targeted NGS panel

  The mutational status of 121 genes recurrently altered in B-cell lymphoma was examined in 55 of 56 diagnostic and 10 of 12 relapse samples using a custom targeted NGS panel. Libraries were generated from 150 ng of DNA using molecular-barcoded library adapters (ThruPLEX Tag- seq kit; Takara) coupled with a custom hybridization capture-based method (SureSelectXT Target Enrichment System Capture strategy, Agilent Technologies). The quality of the libraries was determined using the Bioanalyzer high sensitivity DNA kit (Agilent) and quantified by PCR using the KAPA library quantification kit (KAPA Biosystems). Finally, the libraries were pooled and sequenced in the MiSeq instrument (Illumina).

  Dataset EGAD00001010842

• RNASeq profiles of ROBUST clinical trial and processed WGS mutation calls output

  The dataset contains RNAseq profiles of 1040 patients from the ROBUST clinical trial (NCT02285062). The Allprep DNA/RNA FFPE kit was used to simultaneously purify genomic DNA and total RNA from formalin-fixed, paraffin embedded (FFPE) tissue sections. RNAseq libraries (75PE, 50M) were constructed using Illumina TruSeq RNA Access method. Fastq files are included. Also includes processed WGS mutation calls output.

  Dataset EGAD50000000482

• RNA Sequencing of Control and Myotonic Dystrophy Type 1 Cells During Myogenic Differentiation

  To investigate gene expression dynamics during myogenic differentiation in myotonic dystrophy type 1, RNA was collected from immortalized control, patient-derived, and CRISPR/Cas9-corrected myoblasts at proliferation (day -2) and at days 1 and 5 of differentiation. High-quality RNA was isolated and sequenced using poly(A)-enriched or rRNA-depleted protocols, yielding 100 bp paired-end reads with high coverage. A subset of samples at day 1 underwent deeper sequencing to enhance transcriptome resolution.

  Dataset EGAD50000001647

• Using RNA-sequencing to characterize the resistance to lirafugratinib

  In addition to Exome-sequencing, we used RNA-sequencing to also characterize resistance to lirafugratinib with whole exome sequencing in patients with FGFR2-driven cancers, treated in the phase 1/2 ReFocus trial (NCT04526106) and enrolled in the UNLOCK program at Gustave Roussy

  Study EGAS50000001370

• Single-cell RNA sequencing of erythroid and megakaryocytic acute myeloid leukemia patient cells

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells of a patient with acute myeloid leukemia with erythroid differentiation of the blasts and on peripheral blood mononuclear cells of a patient with acute myeloid leukemia with megakaryocytic differentiation of the blasts. The dataset contains raw fastq files of these two samples with single-cell RNA sequencing performed using the 10x Genomics platform.

  Dataset EGAD00001009865